Ulmus bergmanniana

C.K.Schneid. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Ulmaceae/Ulmus

At a glance

Occurrence records162

Data sources10

Biological traits11

DNA specimens3

eDNA detections1

Sources10 archives

Databases and archives Ulmus bergmanniana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility162 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF162 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Ulmus bergmanniana var. lasiophylla C. K. Schneid. is endemic to China, on mountain slopes at elevations of 2100–2900 m in Gansu, Shaanxi, north-west Sichuan, south-east Xizang (formerly Tibet), and north-west Yunnan.Fu, L., Xin, Y. & Whittemore, A. (2002). Ulmaceae, in Wu, Z. & Raven, P. (eds) Flora of China, Vol. 5 (Ulmaceae through Basellaceae). Science Press, Beijing, and Missouri Botanical Garden Press, St. Louis, USA. [1]

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height23 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment5

Climatetemperate

Elevation max2 500 m

Elevation min2 500 m

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulmus bergmanniana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH703160.1 ↗306 bpChina · 2010

ACGT

GTTGCGCCCGAAGCCATCCGGCCGAGGGCACGTCTGCCTGGGCGTCACACACCGTTGCCCCCCCAAACCCCGTCGGGGAAGAAGGGGGGC …

Ulmus bergmanniana voucher NWH101 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ulmus bergmanniana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Santamour, F. S. & G. H. Ware. 1997. Chromosome numbers of new Ulmus (elm) taxa introduced from China. Rhodora 99: 148–151.

CCDB · ipcn-api-dl — Li, Z. b., Q. j. Zheng, Z. p. Zhang & Y. m. Zhang. 1997. Karyotype analysis of four species of ser. Glabrae in the genus Ulmus L. Acta Agric. Univ. Henan. 31(2): 137–140.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type162 records

Museum / vouchered162

Range

Area of Occupancy AOO356 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence162

10Collections & institutions

Holding institutions19 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	56
Beijing, CN	31
Yangling, CN	15
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	6
Changsha, CN	6
CASlocation not on record	4
Xian, CN	4
Wuhan, CN	4
Lanzhou, CN	3
Zhengzhou, CN	3
Zhuzhou, CN	3
Chongqing, CN	3
Guangzhou, CN	3
Taipei, TW	2
Guilin, CN	2
Museum of the Rockieslocation not on record	2
Nanjing, CN	2
WNNUlocation not on record	2
Wuhan, CN	1
Chengdu, CN	1
Fujian Institute of Subtropical Botanylocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Xining, CN	1
Central China Agricultural Universitylocation not on record	1
Beijing, CN	1
Chinese Academy of Forestrylocation not on record	1
Nanjing, CN	1
Strecker Museum, Baylor Universitylocation not on record	1

29 institutions · 162 of 162 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Ulmus bergmanniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)