Ulex parviflorus
Pourr. · speciesAt a glance
Occurrence records76 155
Data sources10
Biological traits25
DNA specimens1
eDNA detections1
Sources10 archives
Databases and archives Ulex parviflorus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility76 155 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics1 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources25 traits
Chemical compositionLOTUS · NPASS21 compounds
Occurrence & distributionGBIF76 155 records
Environmental DNA1 datasets · 0 countries1 detections
DNA & barcodingBOLD · NCBI1 specimens
Genome at a glanceCCDB2n = 32
01Narrative
Ulex parviflorus, l’Ajonc de Provence ou Ajonc à petites fleurs, est une espèce de plantes à fleurs du genre Ulex et de la famille des Fabacées. Elle fait partie des plantes méditerranéennes dont la floraison est la plus précoce : dès le mois de janvier, en même temps que le romarin et le mimosa, il parsème le maquis et la garrigue de touffes jaune doré hérissées d'épines très pointues. Il est connu en Languedoc et en Provence sous les noms d'argelàs, argelat ou argeràs, également donnés au genêt épineux. Nom catalan : gatosa. Castillan : tojo, aulaga morisca.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYGIFT
Size & morphology5
Leaf size141 mm²
Plant height0.38 m
Seed mass5.48 mg
⚠ sources differ — TRY: 5.48 mg · GIFT: 4.17 mg
Seed mass max4.17 mg
Seed mass min4.17 mg
Life cycle & reproduction6
Deciduousnessevergreen
Dispersal typewind
Life formshrub
Life span5-25
⚠ sources differ — TRY: 5-25 · GIFT: perennial
Lifespan years6 years
Raunkiær life formphanerophyte
Habitat & environment7
Climatesubtropical
Climber detailedself-supporting
Elevation mean979 m
Fruit fleshinessdry
Growth formshrub
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry7
Leaf C:N ratio18.55 g/g
Leaf c435 mg/g
Leaf dry-matter content (LDMC)253 mg/g
Leaf n23.92 mg/g
Leaf p0.6 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)13.4 mm²/mg
03Chemical composition21 compounds
Compounds documented for Ulex parviflorus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Pterocarpan5
Quinolizidine alkaloids4
Pyridine alkaloids $ Quinolizidine alkaloids3
Isoflavones2
Anthocyanidins2
Documented compounds21 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Maackiain | present | LOTUS | |
| (1R,12R)-15,16,17-trimethoxy-5,7,11,19-tetraoxapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene | present | LOTUS | |
| (1R,12R)-15-methoxy-5,7,11,19-tetraoxapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaen-16-ol | present | LOTUS | |
| (1R,12R)-17-methoxy-5,7,11,19-tetraoxapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13(18),14,16-hexaen-16-ol | present | LOTUS | |
| (1R,2R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one | present | LOTUS | |
| (1R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadec-2-en-6-one | present | LOTUS | |
| (1S,12S)-16,17-dimethoxy-5,7,11,19-tetraoxapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaen-15-ol | present | LOTUS | |
| (2R)-6-(2,2-dimethylchromen-6-yl)-4-hydroxy-2-(2-hydroxypropan-2-yl)-2,3-dihydrofuro[3,2-g]chromen-5-one | present | LOTUS | |
| (3S)-7-hydroxy-3-(6-methoxy-1,3-benzodioxol-5-yl)-2,3-dihydrochromen-4-one | present | LOTUS | |
| (3S,4S,4aS,6aR,6bS,8aR,9R,12aR,14aR,14bR)-4-(hydroxymethyl)-4,6a,6b,8a,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-3,9-diol | present | LOTUS |
05DNA & barcoding1 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulex parviflorus has left across the world's sequence archives.
At a glance
DNA specimens1
Marker genes2
GenBank sequences10
eDNA detections1
The DNA barcodea real sequence read deposited for this species
TACTCAGGGATGGCTAGAGGTGTTCGCACCTCGGTCCCCCTCGTGTCGGGATGTGCTCCACCTTGTGTGTTGTCTTCCTGGCCCAATAAC …
Ulex parviflorus subsp. jussiaei voucher LISI_021078a internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL★ITS10
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Ulex parviflorus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidydiploid inferred
Chromosome records32–962n range32median32mode40records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3223×CCDB · iber-fl · CCDB · fl-europaea · CCDB · mediterranean +4
CCDB · iber-fl — Estudio taxonmico de los gneros Ulex L. y Stauracanthus Link. en la pennsula Ibrica. Madrid. Cubas Domnguez, P.*(1984).
CCDB · iber-fl — Nmeros cromosomticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Cubas Domnguez, P.Anales Jard. Bot. Madrid43(2): 217-233(1987).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · fl-europaea — Castro, 1943
CCDB · mediterranean
CCDB · ipcn-api-dl — Tahiri, H. 2006. Mediterranean chromosome number reports 16 (1604--1612). Fl. Medit. 16: 443–449.
CCDB · ipcn-api-dl — Tahiri. 2005. Mediterranean chromosome number reports 15 (1428--1437). Fl. Medit. 15: 702–710.
CCDB · ipcn-api-dl — Fernandes, R. B. 1976. Cucurbitaceae de Cabo Verde. Garcia Orta, Sér. Bot. 3(1): 1–14.
CCDB · ipcn-api-dl — Cubas, P. 1987. Números cromosomáticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Anales Jard. Bot. Madrid 43: 217–233.
CCDB · book-ipcn75-78 — Fernandez Piqueras & Ruiz Rejon 1976
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Tahiri, H., Cubas, P. & Pardo, C. (2005). Reports (1428-1437). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-15 Fl. Medit. 15: 702-710
CCDB · CromoCat 2015 — Dalgaard, V. (1986a). Chromosome studies in flowering plants from Macaronesia. Anales Jard. Bot. Madrid 43: 83-111.
CCDB · CromoCat 2015 — Cubas Domínguez, P. (1984). Estudio taxonómico de los géneros Ulex L. y Stauracanthus Link. en la península Ibérica. Madrid
CCDB · CromoCat 2015 — Cubas Domínguez, P. (1987). Números cromosomáticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Anales Jard. Bot. Madrid 43(2): 217-233.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.
2n 9613×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +1
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 1-34. Valds Bermejo, E.Anales Jard. Bot. Madrid36: 373-389(1980).
CCDB · iber-fl — Estudio taxonmico de los gneros Ulex L. y Stauracanthus Link. en la pennsula Ibrica. Madrid. Cubas Domnguez, P.*(1984).
CCDB · iber-fl — Nmeros cromosomticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Cubas Domnguez, P.Anales Jard. Bot. Madrid43(2): 217-233(1987).
CCDB · fl-europaea — Castro. 1945
CCDB · ipcn-api-dl — Valdes-Bermejo, E. 1980. Numeros cromosomaticos de plantas occidentales. 1-34. Anales Jard. Bot. Madrid 36: 373–389.
CCDB · ipcn-api-dl — Cubas, P. 1987. Números cromosomáticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Anales Jard. Bot. Madrid 43: 217–233.
CCDB · ipcn-api-dl — Espírito Santo, M. D., P. Cubas, M. F. Lousão, C. Pardo & J. C. Costa. 1997. Ulex parviflorus sensu lato (Genisteae, Leguminosae) en la zona centro de Portugal. Anales Jard. Bot. Madrid 55(1): 49–65.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.
2n 644×CCDB · iber-fl · CCDB · fl-europaea
CCDB · iber-fl — Estudio taxonmico de los gneros Ulex L. y Stauracanthus Link. en la pennsula Ibrica. Madrid. Cubas Domnguez, P.*(1984).
CCDB · iber-fl — Nmeros cromosomticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Cubas Domnguez, P.Anales Jard. Bot. Madrid43(2): 217-233(1987).
CCDB · fl-europaea — Castro, 1945
n 1615×CCDB · iber-fl · CCDB · mediterranean · CCDB · ipcn-api-dl +2
CCDB · iber-fl — Contribuiao para o conhecimento cariolgico dos gneros Ulex L. Stauracanthus Link e Nepa Webb. Castro, D.Agron. Lusit.5: 243-249(1943).
CCDB · iber-fl — Estudios cariolgicos sobre la flora espaola. Fernndez Piqueras, J. & M. Ruz Rejn.Bol. Soc. Brot. ser. 250: 5-13(1976).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 72. Ruz Rejn, M. & J. Fernndez Piqueras.Lagascalia8(1): 120-121(1978).
CCDB · iber-fl — Estudio taxonmico de los gneros Ulex L. y Stauracanthus Link. en la pennsula Ibrica. Madrid. Cubas Domnguez, P.*(1984).
CCDB · iber-fl — Nmeros cromosomticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Cubas Domnguez, P.Anales Jard. Bot. Madrid43(2): 217-233(1987).
CCDB · mediterranean
CCDB · ipcn-api-dl — Fernandes, R. B. 1976. Cucurbitaceae de Cabo Verde. Garcia Orta, Sér. Bot. 3(1): 1–14.
CCDB · ipcn-api-dl — Tahiri. 2005. Mediterranean chromosome number reports 15 (1428--1437). Fl. Medit. 15: 702–710.
CCDB · book-ipcn75-78 — Fernandez Piqueras & Ruiz Rejon 1976
CCDB · CromoCat 2015 — Castro, D. (1943). Contribuiçao para o conhecimento cariológico dos géneros Ulex L. Stauracanthus Link e Nepa Webb. Agron. Lusit. 5: 243-249.
CCDB · CromoCat 2015 — Fernández Piqueras, J. & Ruíz Rejón, M. (1976). Estudios cariológicos sobre la flora española. Bol. Soc. Brot. 50: 5-13.
CCDB · CromoCat 2015 — Ruiz Rejón, M. & J. Fernández Piqueras. (1978). Números cromosómicos para la flora española, 72. Lagascalia 8(1): 120-121.
CCDB · CromoCat 2015 — Dalgaard, V. (1986a). Chromosome studies in flowering plants from Macaronesia. Anales Jard. Bot. Madrid 43: 83-111.
CCDB · CromoCat 2015 — Cubas Domínguez, P. (1984). Estudio taxonómico de los géneros Ulex L. y Stauracanthus Link. en la península Ibérica. Madrid
CCDB · CromoCat 2015 — Cubas Domínguez, P. (1987). Números cromosomáticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Anales Jard. Bot. Madrid 43(2): 217-233.
n 486×CCDB · iber-fl · CCDB · ipcn-api-dl
CCDB · iber-fl — Estudio taxonmico de los gneros Ulex L. y Stauracanthus Link. en la pennsula Ibrica. Madrid. Cubas Domnguez, P.*(1984).
CCDB · iber-fl — Nmeros cromosomticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Cubas Domnguez, P.Anales Jard. Bot. Madrid43(2): 217-233(1987).
CCDB · ipcn-api-dl — Cubas, P. 1987. Números cromosomáticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Anales Jard. Bot. Madrid 43: 217–233.
CCDB · ipcn-api-dl — Espírito Santo, M. D., P. Cubas, M. F. Lousão, C. Pardo & J. C. Costa. 1997. Ulex parviflorus sensu lato (Genisteae, Leguminosae) en la zona centro de Portugal. Anales Jard. Bot. Madrid 55(1): 49–65.
n 324×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Estudio taxonmico de los gneros Ulex L. y Stauracanthus Link. en la pennsula Ibrica. Madrid. Cubas Domnguez, P.*(1984).
CCDB · iber-fl — Algumas contagens de cromosomas no gnero Ulex L. (sensu lato). Castro, D.Agron. Lusit.3(2): 103-110(1941).
CCDB · CromoCat 2015 — Ruiz Rejón, M. & J. Fernández Piqueras. (1978). Números cromosómicos para la flora española, 72. Lagascalia 8(1): 120-121.
CCDB · CromoCat 2015 — Cubas Domínguez, P. (1984). Estudio taxonómico de los géneros Ulex L. y Stauracanthus Link. en la península Ibérica. Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type76 155 records
Wild obs. + sensor75 340
Museum / vouchered276
Other539
Origin
Native8 547
Range
Area of Occupancy AOO35 996 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 55 442≤1 km 9 833≤10 km 6 493>10 km 210
71 978 georeferenced · 3 362 without coordinates
Open the mapobservation + sensor75 340
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy56% within 1 km
≤100 m 10≤1 km 65≤10 km 60
135 georeferenced · 141 without coordinates
Open the institutions mapphysical evidence276
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions18 of 38 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| València, ES | 54 |
| LDlocation not on record | 30 |
| BClocation not on record | 20 |
| Museo Achille Folettolocation not on record | 17 |
| College of the Atlantic, Museumlocation not on record | 16 |
| MAlocation not on record | 10 |
| Sevilla, ES | 9 |
| BDBClocation not on record | 9 |
| Phyletisches Museum Jenalocation not on record | 8 |
| UIBlocation not on record | 8 |
| Wlocation not on record | 7 |
| Barcelona, ES | 6 |
| CICYTEXlocation not on record | 5 |
| JBSlocation not on record | 5 |
| ISAlocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| San Sebastián, ES | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| Granada, ES | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Dresden, DE | 2 |
| Salamanca, ES | 2 |
| Madrid, ES | 2 |
| Badajoz, ES | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Madrid, ES | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Bourges, FR | 2 |
| Oskarshamn, SE | 1 |
| Vitoria, ES | 1 |
| Edinburgh, GB | 1 |
| Jaén, ES | 1 |
| University of Stellenboschlocation not on record | 1 |
| Alicante, ES | 1 |
| BRNUlocation not on record | 1 |
| Paris, FR | 1 |
| Córdoba, ES | 1 |
38 institutions · 253 of 276 vouchered records shown · 23 without an institution code
09Environmental DNA1 detections
Where the DNA of Ulex parviflorus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.