Ulex europaeus
speciesAt a glance
Occurrence records331 450
Data sources16
Biological traits73
DNA specimens27
eDNA detections19
Sources16 archives
Databases and archives Ulex europaeus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility331 450 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources73 traits
Chemical compositionLOTUS · NPASS87 compounds
Occurrence & distributionGBIF331 450 records
Environmental DNA1 datasets · 6 countries19 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB · GIFT · GoaT3.5 Gbp
01Narrative
Ulex europaeus, l'ajonc d'Europe, est une espèce de plantes à fleurs dicotylédones de la famille des Fabaceae, sous-famille des Faboideae, originaire d'Europe occidentale. C'est un arbuste épineux, à feuillage persistant, qui pousse en formant des fourrés impénétrables. C'est une espèce très compétitive, capable lorsqu'elle est bien établie de déplacer les plantes cultivées ou spontanées indigènes grâce à sa capacité de fixer l'azote et d'acidifier le sol. Originaire des régions maritimes Atlantiques d'Europe, cet arbuste a été largement introduit, notamment pour former des haies, dans toutes les régions tempérées du monde où il s'est naturalisé. Il s'est également établi dans certaines îles tropicales en altitude. - Noms vernaculaires - ajonc d'Europe, grand ajonc, landier, genêt épineux, ajonc, ajonc épineux, argelat, bois-jonc, dorne, genêt blanc, jan, jonc marin, lande, sainfoin d'hiver, thuie, touye, vigneau, vignon.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology27
Fruit length15 mm
⚠ sources differ — AusTraits: 15 mm · GIFT: 19 mm
Fruit length max20 mm
Fruit length min10 mm
Fruit width6 mm
Fruit width max8 mm
Fruit width min5 mm
Leaf length18.5 mm
Leaf length max30 mm
Leaf length min4 mm
Leaf mass3.64 mg
Leaf size14.5 mm²
Leaf width1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 3 mm
Leaf width max3 mm
Leaf width min3 mm
Plant height1.12 m
⚠ sources differ — GIFT: 1.12 m · AusTraits: 3 m · LEDA: 0.9 m · TRY: 2 m
Plant height generative1.2 m
Plant height max3 m
Plant height min0.5 m
Seed length3.04 mm
⚠ sources differ — TRY: 3.04 mm · AusTraits: 3 mm · GIFT: 3.3 mm
Seed length max3.3 mm
Seed length min3.3 mm
Seed mass6.45 mg
Seed mass max9 mg
Seed mass min4.2 mg
Seed width2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction18
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeanimal+self
⚠ sources differ — AusTraits: ballistic myrmecochory zoochory · LEDA: autochor · GIFT: autochorous
Flower colouryellow
Flowering endApr
Flowering startApr
Flowering timennnnnnnnyyyn
Life formshrub
Life spanperennial
Lifespan years8 years
⚠ sources differ — TRY: 8 years · GIFT: 20 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number278
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 180 m
Elevation min0 m
Epiphyteterrestrial
Fruit typelegume
Growth formshrub
Habitat GIFTÁrea Antrópica, Campo de Altitude, Campo Limpo
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelinear
Mycorrhizapresent
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry8
Leaf dry-matter content (LDMC)303 mg/g
⚠ sources differ — TRY: 303 mg/g · LEDA: 248 mg/g
Leaf n31.48 mg/g
Leaf p2.5 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
⚠ sources differ — TRY: C3 · AusTraits: c3-cam · GIFT: C3
Seed longevity index0
Specific leaf area (SLA)10.28 mm²/mg
⚠ sources differ — TRY: 10.28 mm²/mg · LEDA: 8.5 mm²/mg · GIFT: 8.2 mm²/mg
Wood density465 mg/cm³
Other traits3
Defenseyes
Diaspore typegenerative dispersule
Seeds per fruit>1000
03Chemical composition87 compounds
Compounds documented for Ulex europaeus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Lanostane, Tirucallane and Euphane triterpenoids $ Oleanane triterpenoids17
Pyridine alkaloids $ Quinolizidine alkaloids12
Isoflavones11
Isoflavanones7
Quinolizidine alkaloids5
Documented compounds87 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Lupanine | present | LOTUS | |
| (-)-Cytisine | present | NPASS | |
| (-)-Maackiain | present | LOTUS | |
| (1R,2R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one | present | LOTUS | |
| (1R,9R)-11-methyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one | present | LOTUS | |
| (1R,9R)-6-oxo-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-diene-11-carbaldehyde | present | LOTUS | |
| (1R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadec-2-en-6-one | present | LOTUS | |
| (1S,5R)-1,2,3,4,5,6-Hexahydro-1,5-methano-8H-pyrido(1,2-a)(1,5)diazocin-8-one | present | LOTUS | |
| (1S,9R)-11-acetyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one | present | LOTUS | |
| (1S,9R)-11-but-3-enyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one | present | LOTUS |
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulex europaeus has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes5
GenBank sequences10
eDNA detections19
Countries6
The DNA barcodea real sequence read deposited for this species
GAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCCTGTGCCTTGGCCATGTCCTAG …
Ulex europaeus voucher EDNA20-0060235 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★ITS8★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Ulex europaeus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 540 360 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Ulex europaeus3.54 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 96 n = 48
Ploidypolyploid inferred
Chromosome records32–962n range96median96mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 9618×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · iber-fl +7
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Fernandez Prieto, J.A., Vera, M.L., Alvarez Martinez, M.J., Diaz, T.E., Fernandez Casado, M.A., Fernandez-Carvajal, M.C., Gutierrez Villarias, M.I., Nava, H.S. Bot. J. Linn. Soc. 113: 35-39 (1993)
CCDB · brit-fl — Bullock, J.M., Connor, J., Carrington, S., Edwards, R.J. Watsonia 22: 143-152 (1998)
CCDB · brit-fl — Gilmour, S. (1988)
CCDB · iber-fl — Estudio taxonmico de los gneros Ulex L. y Stauracanthus Link. en la pennsula Ibrica. Madrid. Cubas Domnguez, P.*(1984).
CCDB · iber-fl — Nmeros cromosomticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Cubas Domnguez, P.Anales Jard. Bot. Madrid43(2): 217-233(1987).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3015
CCDB · fl-europaea — Lovkvist, 1963
CCDB · ipcn-api-dl — Castroviejo, S. & E. Valdes-Bermejo. 1983. Notas sobre los Tojos Gallegos. Anales Jard. Bot. Madrid 41: 73–81.
CCDB · ipcn-api-dl — Cubas, P. 1987. Números cromosomáticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Anales Jard. Bot. Madrid 43: 217–233.
CCDB · ipcn-api-dl — Cubas, P. & C. Pardo. 1997. Correlations between chromosomal and morphological characters in subspecies of Ulex europaeus L. (Genisteae, Leguminosae) from the north-west of the Iberian Peninsula. Bot. J. Linn. Soc. 125: 229–243.
CCDB · book-northern-plants — de Castro 1941.
CCDB · kew — Misset MT, Gourret JP. 1996. Flow cytometric analysis of the different ploidy levels observed in the genus Ulex L. Faboideae-Genisteae in Brittany (France). Botanica Acta 109: 72-79.
CCDB · CromoCat 2015 — Cubas Domínguez, P. (1984). Estudio taxonómico de los géneros Ulex L. y Stauracanthus Link. en la península Ibérica. Madrid
CCDB · CromoCat 2015 — Cubas Domínguez, P. (1987). Números cromosomáticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Anales Jard. Bot. Madrid 43(2): 217-233.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.
CCDB · CromoCat 2015 — Fernández Prieto, J. A., Vera, M. L., Alvarez Martínez, M. J. & Díaz, T. E. (1993). Chromosome numbers and geographical distribution of Ulex europeus subsp. europeus (Leguminosae). Bot. J. Linn. Soc. 113: 35-39.
GIFT · GIFT (floras)
2n 643×CCDB · CromoCat 2015 · GIFT · GIFT (floras)
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.
CCDB · CromoCat 2015 — Fernández Prieto, J. A., Vera, M. L., Alvarez Martínez, M. J. & Díaz, T. E. (1993). Chromosome numbers and geographical distribution of Ulex europeus subsp. europeus (Leguminosae). Bot. J. Linn. Soc. 113: 35-39.
GIFT · GIFT (floras)
2n 321×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Fernández Prieto, J. A., Vera, M. L., Alvarez Martínez, M. J. & Díaz, T. E. (1993). Chromosome numbers and geographical distribution of Ulex europeus subsp. europeus (Leguminosae). Bot. J. Linn. Soc. 113: 35-39.
n 488×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Estudio taxonmico de los gneros Ulex L. y Stauracanthus Link. en la pennsula Ibrica. Madrid. Cubas Domnguez, P.*(1984).
CCDB · iber-fl — Nmeros cromosomticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Cubas Domnguez, P.Anales Jard. Bot. Madrid43(2): 217-233(1987).
CCDB · ipcn-api-dl — Misset, M. T. 1990. Données carylogiques chez le genre Ulex L. (Papilionoideae) dans les Massif Amoricain. Taxon 30: 630–635.
CCDB · ipcn-api-dl — Cubas, P. 1987. Números cromosomáticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Anales Jard. Bot. Madrid 43: 217–233.
CCDB · ipcn-api-dl — Cubas, P. & C. Pardo. 1997. Correlations between chromosomal and morphological characters in subspecies of Ulex europaeus L. (Genisteae, Leguminosae) from the north-west of the Iberian Peninsula. Bot. J. Linn. Soc. 125: 229–243.
CCDB · CromoCat 2015 — Cubas Domínguez, P. (1984). Estudio taxonómico de los géneros Ulex L. y Stauracanthus Link. en la península Ibérica. Madrid
CCDB · CromoCat 2015 — Cubas Domínguez, P. (1987). Números cromosomáticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Anales Jard. Bot. Madrid 43(2): 217-233.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type331 450 records
Wild obs. + sensor323 990
Museum / vouchered5 280
Cultivated / captive2 138
Other42
Origin
Native40 426
Introduced19 891
Range
Area of Occupancy AOO259 412 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy49% within 1 km
≤100 m 77 463≤1 km 67 758≤10 km 147 164>10 km 1 761
294 146 georeferenced · 29 844 without coordinates
Open the mapobservation + sensor323 990
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 296≤1 km 465≤10 km 533>10 km 49
1 343 georeferenced · 3 937 without coordinates
Open the institutions mapphysical evidence5 280
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy11% within 1 km
≤1 km 1≤10 km 1>10 km 7
9 georeferenced · 2 129 without coordinates
Open the mapnot free-living2 138
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions118 of 217 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 2 747 |
| LDlocation not on record | 181 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 136 |
| MeiseBGlocation not on record | 123 |
| Christchurch, NZ | 114 |
| Adelaide, AU | 110 |
| Museo Entomologico de Leonlocation not on record | 95 |
| Brussel, BE | 81 |
| Oskarshamn, SE | 56 |
| Hobart, AU | 52 |
| Mount Annan, AU | 50 |
| Auckland, NZ | 47 |
| Canberra, AU | 35 |
| Rotorua, NZ | 32 |
| MAlocation not on record | 30 |
| Olocation not on record | 30 |
| Jardín Botanico de Bogotá José Celestino Mutis (JBB)location not on record | 27 |
| South Kensington, GB | 26 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 24 |
| Adam Mickiewicz University in Poznańlocation not on record | 23 |
| Görlitz, DE | 22 |
| National Biodiversity Institute, Costa Ricalocation not on record | 22 |
| Santiago de Compostela, ES | 22 |
| Canadian Department of Agriculturelocation not on record | 21 |
| Parkville, AU | 18 |
| Corvallis, US | 18 |
| Universidad de Antioquia (UdeA)location not on record | 18 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 18 |
| WTUlocation not on record | 16 |
| Kensington, AU | 16 |
| Pretoria, ZA | 16 |
| Victoria, CA | 15 |
| Armidale, AU | 15 |
| Bern, CH | 15 |
| Porto Alegre, BR | 14 |
| Wellington, NZ | 13 |
| Blumenau, BR | 12 |
| Pullman, US | 11 |
| Brisbane, AU | 11 |
| Universidad de La Salle (La Salle)location not on record | 11 |
| Saint Louis, US | 11 |
| Bronx, US | 10 |
| Davis, US | 10 |
| Arcata, US | 10 |
| TAFORI-LSRClocation not on record | 8 |
| Entomological Society of Latvialocation not on record | 8 |
| KMNlocation not on record | 8 |
| CICYTEXlocation not on record | 8 |
| Tacoma, US | 8 |
| San Francisco, US | 8 |
| Tilburg, NL | 8 |
| Chicago, US | 7 |
| Universidad Nacional de Colombia (UNAL)location not on record | 7 |
| BClocation not on record | 7 |
| Salamanca, ES | 7 |
| Uniwersytet Jagiellońskilocation not on record | 7 |
| Portland, US | 7 |
| UGentlocation not on record | 7 |
| Durban, ZA | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| PUC-RSlocation not on record | 6 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| Dresden, DE | 6 |
| CASlocation not on record | 6 |
| Claremont, US | 5 |
| San Diego, US | 5 |
| Vitoria, ES | 5 |
| La Trobe Universitylocation not on record | 5 |
| Wollongong, AU | 5 |
| QVMAGlocation not on record | 5 |
| DBF-NHMDlocation not on record | 5 |
| Kew, GB | 5 |
| Lake Charles, US | 5 |
| CJBGlocation not on record | 5 |
| Bourges, FR | 5 |
| Riverside, US | 5 |
| Badajoz, ES | 5 |
| Wlocation not on record | 4 |
| Provincia di Livornolocation not on record | 4 |
| Pondicherry, IN | 4 |
| Ivano-Frankivsk, UA | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Criciúma, BR | 4 |
| Uppsala, SE | 4 |
| Trondheim, NO | 4 |
| UNESClocation not on record | 4 |
| Moscow State Universitylocation not on record | 4 |
| BISHlocation not on record | 4 |
| Porrentruy, CH | 4 |
| SLU Artdatabankenlocation not on record | 4 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 4 |
| Universidad Católica de Oriente (UCO)location not on record | 4 |
| Staten Island, US | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Angwin, US | 3 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 3 |
| Philadelphia, US | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| Santa Barbara, US | 3 |
| Córdoba, AR | 3 |
| US | 3 |
| San Isidro, AR | 3 |
| Xiamen, CN | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| BDBClocation not on record | 3 |
| Bend, US | 3 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| Vancouver, CA | 3 |
| Helsinki, FI | 3 |
| Frankfurt am Main | 3 |
| Paris, FR | 2 |
| Moscow, US | 2 |
| UNESP-FCAlocation not on record | 2 |
| Barcelona, ES | 2 |
| Batemans Bay, AU | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| HUAlocation not on record | 2 |
| ASUlocation not on record | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 2 |
| Alicante, ES | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Nijmegen, NL | 2 |
| ISAlocation not on record | 2 |
| San Jose, US | 2 |
| Logan, US | 2 |
| València, ES | 2 |
| Boise, US | 2 |
| LfUlocation not on record | 2 |
| Nanjing, CN | 2 |
| Salvador, BR | 2 |
| BSBIlocation not on record | 2 |
| Fredericksburg, US | 2 |
| Chengdu, CN | 2 |
| UFPRlocation not on record | 2 |
| JBRJlocation not on record | 2 |
| Beijing, CN | 1 |
| UFSJlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Burlington, US | 1 |
| Zürich, CH | 1 |
| BRNUlocation not on record | 1 |
| Cape Town, ZA | 1 |
| Boumlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| FFPRIlocation not on record | 1 |
| Turlock, US | 1 |
| Pamplona, ES | 1 |
| NMBU:MINAlocation not on record | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Long Beach, US | 1 |
| Wuzhou, CN | 1 |
| BFLlocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Ashland, US | 1 |
| Caldwell, US | 1 |
| San Luis Obispo, US | 1 |
| Odawara, JP | 1 |
| ESALQlocation not on record | 1 |
| Madrid, ES | 1 |
| Berlin, DE | 1 |
| WAGlocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Clemson, US | 1 |
| Banyoles, ES | 1 |
| Northridge, US | 1 |
| Göteborg, SE | 1 |
| H-Schuhwlocation not on record | 1 |
| SNSNMClocation not on record | 1 |
| Taipei, TW | 1 |
| UFSMlocation not on record | 1 |
| San Angelo, US | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| LNBG$location not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Brookings, US | 1 |
| Monastir, TN | 1 |
| UFMGlocation not on record | 1 |
| Chapel Hill, US | 1 |
| UNICAMPlocation not on record | 1 |
| Sion, CH | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Aarhus, DK | 1 |
| Tampa, US | 1 |
| QCNElocation not on record | 1 |
| Plocation not on record | 1 |
| Santa Cruz, US | 1 |
| Denver, US | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Bloomington, US | 1 |
| Mexico City, MX | 1 |
| Edinburgh, GB | 1 |
| Mérida, MX | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Whitehorse, CA | 1 |
| Los Angeles, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Palmerston, AU | 1 |
| GJOlocation not on record | 1 |
| Oswego, US | 1 |
| UNIVILLElocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Smithfield, AU | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Fulda, DE | 1 |
| Davenport, US | 1 |
| UnBlocation not on record | 1 |
| UFSClocation not on record | 1 |
| Valparaiso, CL | 1 |
217 institutions · 4 849 of 5 280 vouchered records shown · 424 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Ulex europaeus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map6 countries0
Open coastal sage scrub. Associates: Artemis…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.3 °C 3.60–15.4
Seasonal swing summer↔winter13.6 °C
Max temp (day)16.2 °C 4.70–20.2
Min temp (night)9.70 °C 2.40–12.0
Precipitation70.4 mm/mo 54.5–86.0
Air humidity62.8 % 57.9–65.6
Moisture balance-24.5 mm/mo -43.1–14.5
Vapour deficit595 Pa 280–740
Wind speed4.10 m/s 2.70–5.50
Cloud cover49.3 % 40.7–53.5
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.