Ulex densus

Welw. ex Webb · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Ulex

At a glance

Occurrence records398

Data sources9

Biological traits7

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Ulex densus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility398 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionLOTUS17 compounds

Occurrence & distributionGBIF398 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 64

01Narrative

Ulex densus (Portuguese: tojo-gatunho or tojo-da-charneca) is an evergreen shrub in the family Fabaceae endemic to Portugal.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.35 m

Seed mass3.2 mg

Life cycle & reproduction2

DeciduousnessPhyllodium

Life formsubshrub

Habitat & environment2

Climatetemperate

Growth formshrub

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition17 compounds

Compounds documented for Ulex densus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Quinolizidine alkaloids9

Pyridine alkaloids $ Quinolizidine alkaloids7

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Thermopsine	present	LOTUS
(1R,2R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one	present	LOTUS
(1R,9R)-11-methyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one	present	LOTUS
(1R,9R)-6-oxo-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-diene-11-carbaldehyde	present	LOTUS
(1R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadec-2-en-6-one	present	LOTUS
(1S,5R)-1,2,3,4,5,6-Hexahydro-1,5-methano-8H-pyrido(1,2-a)(1,5)diazocin-8-one	present	LOTUS
(1S,9R)-11-acetyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one	present	LOTUS
(1S,9R)-11-but-3-enyl-7,11-diazatricyclo[7.3.1.02,7]trideca-2,4-dien-6-one	present	LOTUS
(1S,9S,10R,12S)-12-hydroxy-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadeca-2,4-dien-6-one	present	LOTUS
(2R,7R,9S,9aR)-9-(hydroxymethyl)-7-(6-methoxy-2-pyridinyl)-2,3,4,6,7,8,9,9a-octahydro-1H-quinolizin-2-ol	present	LOTUS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulex densus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

The DNA barcodea real sequence read deposited for this species

ITSAF384357.1 ↗228 bp

ACGT

ATCGTTGCCCCTGTGCCTTGGCCATGTCTTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCATTGTCTCACGGTTGGTTGAAAA …

Ulex densus internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ulex densus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Ploidypolyploid inferred

Chromosome records64–642n range64median64mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 648×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +2

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).

CCDB · iber-fl — Estudio taxonmico de los gneros Ulex L. y Stauracanthus Link. en la pennsula Ibrica. Madrid. Cubas Domnguez, P.*(1984).

CCDB · iber-fl — Nmeros cromosomticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Cubas Domnguez, P.Anales Jard. Bot. Madrid43(2): 217-233(1987).

CCDB · fl-europaea — Castro, 1945

CCDB · ipcn-api-dl — Cubas, P. 1987. Números cromosomáticos en Ulex L. y Stauracanthus Link (Genisteae, Papilionaceae). Anales Jard. Bot. Madrid 43: 217–233.

CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.

CCDB · book-fedorov — Castro 1941, 1945a

CCDB · book-atlas-flowering-plants — Europe

n 322×CCDB · iber-fl

CCDB · iber-fl — Algumas contagens de cromosomas no gnero Ulex L. (sensu lato). Castro, D.Agron. Lusit.3(2): 103-110(1941).

CCDB · iber-fl — Alguns dados cariolgicos para a sistemtica dos gneros Echinospartum, Stauracanthus, Nepa e Ulex. Castro, D.Bol. Soc. Brot. ser. 219: 525-538(1945).

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type398 records

Wild obs. + sensor363

Museum / vouchered34

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 43≤1 km 10≤10 km 127

180 georeferenced · 183 without coordinates

Open the mapobservation + sensor363

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence34

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ISAlocation not on record	17
MAlocation not on record	4
Wlocation not on record	4
València, ES	3
LDlocation not on record	3
Barcelona, ES	1
Vitoria, ES	1
Museo Achille Folettolocation not on record	1

8 institutions · 34 of 34 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)