Uapaca kirkiana

Müll.Arg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Uapaca

At a glance

Occurrence records1 479

Data sources12

Biological traits26

DNA specimens7

eDNA detections6

Sources12 archives

Databases and archives Uapaca kirkiana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 479 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF1 479 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Uapaca kirkiana, the sugar plum or mahobohobo, is a species of dioecious plant in the family Phyllanthaceae. It is native to the southern Afrotropics, where it occurs in well-watered miombo woodlands. Within range it is one of the most popular wild fruits. It is rarely cultivated but trees are left when land is being cleared. Still a traditional food plant in Africa, this little-known fruit has the potential to improve nutrition, boost food security, foster rural development and support sustainable land care. In Shona, the fruit are referred to as mazhanje, and in Chichewa masuku.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length27.5 mm

Fruit width27.5 mm

Plant height12 m

Seed mass400 mg

Seed mass max400 mg

Seed mass min400 mg

Life cycle & reproduction7

Deciduousnessdeciduous

⚠ sources differ — TRY: deciduous · GIFT: evergreen

Dehiscenceindehiscent

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typedrupe

Growth formtree

Habitat GIFTforest

Mycorrhiza typeectomycorrhizal

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density568 mg/cm³

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Uapaca kirkiana has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences2

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKU568166.1 ↗511 bpZambia · 2013

ACGT

AGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Uapaca kirkiana ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★trnL

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Uapaca kirkiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 131×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hans, A. S. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 360.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 479 records

Wild obs. + sensor251

Museum / vouchered191

Cultivated / captive1 037

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 78≤1 km 12≤10 km 3

93 georeferenced · 158 without coordinates

Open the mapobservation + sensor251

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 1>10 km 1

3 georeferenced · 188 without coordinates

Open the institutions mapphysical evidence191

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1 033>10 km 4

1 037 georeferenced

Open the mapnot free-living1 037

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	34
MeiseBGlocation not on record	32
Kew, GB	20
Instituto de Investigação Científica Tropicallocation not on record	12
TAFORI-LSRClocation not on record	7
Stockholm, SE	4
Fort Worth, US	3
Uppsala, SE	3
Bronx, US	2
Chongqing Museumlocation not on record	2
Arusha, TZ	2
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	2
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Coimbra, PT	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Buffelskloof Private Nature Reserve, Herbariumlocation not on record	1

16 institutions · 127 of 191 vouchered records shown · 64 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Uapaca kirkiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 21.8–24.3

Seasonal swing summer↔winter8.20 °C

Max temp (day)28.0 °C 26.0–30.0

Min temp (night)18.1 °C 17.6–18.6

Precipitation77.9 mm/mo 23.3–133

Air humidity56.7 % 50.5–62.9

Moisture balance-75.8 mm/mo -143–-8.90

Vapour deficit1,247 Pa 979–1,516

Wind speed2.90 m/s 2.70–3.10

Cloud cover47.2 % 31.8–62.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Uapaca kirkiana

At a glance

Sources12 archives

Size & morphology6

Life cycle & reproduction7

Diet & foraging1

Habitat & environment9

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 479 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 479 records