Typha lugdunensis — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Typhaceae/Typha

At a glance

Occurrence records18

Data sources7

Biological traits19

DNA specimens1

eDNA detections0

Sources7 archives

Databases and archives Typha lugdunensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF18 records

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Typha lugdunensis is a plant species found in an odd disjunct distribution in Europe and Asia. It has been reported from Germany, Switzerland, France, Iran, Iraq, Turkey, and China (Hebei, Nei Mongol, Shandong, Xinjiang). The species grows in freshwater marshes.Pierre Chabert. 1850. Bulletin of the Horticultural Society Prat. Dep. Rhone 1850: 149, Typha lugdunensis 'Mavrodiev, Evgenij Vladimirovich. 2001. Botanicheskii Zhurnal. Moscow & Leningrad 86(9): 121, Rohrbachia martiniFlora of China v 23 p 163. Typha lugdunensis

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf length625 mm

Leaf length max750 mm

Leaf length min500 mm

Leaf width3 mm

Leaf width max4 mm

Leaf width min2 mm

Plant height0.575 m

Plant height max0.7 m

Plant height min0.45 m

Life cycle & reproduction3

Life formhelophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Typha lugdunensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOK539745.1 ↗161 338 bp

ACGT

CAAAAAATACCCAATATCTTGTTAAAACAAGATATTGGGTATTGTTCCTTTCGTTCAGCGATTCATATACATTAAGACAGAAATCTTATC …

Typha lugdunensis chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PmatK2rbcL2

animal barcodeplant barcode

08Occurrence & distribution

Record type18 records

Museum / vouchered18

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤1 km 8≤10 km 10

18 georeferenced

Open the institutions mapphysical evidence18

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	18

1 institutions · 18 of 18 vouchered records shown