Typha domingensis

Plantae/Tracheophyta/Liliopsida/Poales/Typhaceae/Typha

At a glance

Occurrence records19 751

Data sources14

Biological traits56

DNA specimens13

eDNA detections10

Sources14 archives

Databases and archives Typha domingensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 751 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources56 traits

Chemical compositionLOTUS · NPASS79 compounds

Occurrence & distributionGBIF19 751 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB · GoaT · NCBI≈208 Mbp

01Narrative

Typha domingensis est une espèce de plante vivace monocotylédone du genre Typha et de la famille des Typhaceae. Elle croît dans les zones tempérées de l'hémisphère nord. Elle fleurit au printemps et donne des fruits au milieu de l'automne.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYAusTraitsLEDAGIFTWCVP

Size & morphology21

Fruit length1.2 mm

Fruit length max1.2 mm

Fruit length min1.2 mm

Leaf length2 000 mm

⚠ sources differ — AusTraits: 2 000 mm · GIFT: 950 mm

Leaf length max1 500 mm

Leaf length min400 mm

Leaf size3 142 mm²

Leaf width10 mm

⚠ sources differ — AusTraits: 10 mm · GIFT: 5.5 mm

Leaf width max9 mm

Leaf width min3 mm

Plant height2.3 m

⚠ sources differ — GIFT: 2.3 m · AusTraits: 2.5 m · TRY: 2 m

Plant height max30 m

Plant height min0.7 m

Seed length1.58 mm

Seed mass0.1 mg

⚠ sources differ — TRY: 0.1 mg · AusTraits: 0.124 mg · GIFT: 0.099 mg

Seed mass max0.16 mg

Seed mass min0.04 mg

Seed volume0.008 mm³

Seed volume max0.008 mm³

Seed volume min0.008 mm³

Seed width0.198 mm

Life cycle & reproduction13

Deciduousnessdeciduous

Dispersal typewind

Flowering endAug

Flowering startMay

Flowering timeyynnnnnnnnny

Life formhelophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Self fertilizationabsent

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formherb

Habitat GIFTÁrea Antrópica, Floresta Estacional Perenifólia, Floresta Ombrófila (= Floresta Pluvial), Restinga, Vegetação Aquática

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry5

Leaf n21.6 mg/g

Leaf p1.04 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.99 mm²/mg

Other traits3

Leaf arrangementalternate

Seeds per fruit>1000

Shoot orientationerect

03Chemical composition79 compounds

Compounds documented for Typha domingensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Gallotannins13

Flavonols13

Friedelane triterpenoids7

Unsaturated fatty acids5

Cinnamic acids and derivatives4

Documented compounds79 total

Compound	Amount	Source
(10S,11R,29R,31R,32R)-3,4,5,16,17,18,21,22,23,31,36,37,38-tridecahydroxy-9,12,27,30,33-pentaoxaheptacyclo[33.3.1.02,7.010,32.011,29.014,19.020,25]nonatriaconta-1(39),2,4,6,14,16,18,20,22,24,35,37-dodecaene-8,13,26,34-tetrone	present	NPASS
(1R,2R,20R,37R,44S,45R,49S,50S,56S)-45-(3,4-dihydroxyphenyl)-7,8,9,12,13,14,25,26,27,30,31,32,35,41,44-pentadecahydroxy-3,18,21,38,46,51,54-heptaoxadodecacyclo[27.21.3.334,50.02,20.05,10.011,16.023,28.033,53.037,49.039,48.042,47.037,56]hexapentaconta-5,7,9,11,13,15,23,25,27,29(53),30,32,34,39(48),40,42(47)-hexadecaene-4,17,22,36,52,55-hexone	present	NPASS
(1R,2R,20R,42R,46R)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone	present	NPASS
(1R,2R,20R,42S,46S)-46-[(2R,3S)-2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-3,4-dihydro-2H-chromen-6-yl]-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37-pentadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone	present	NPASS
(1R,2R,20S,42S,46S)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone	present	NPASS
(1R,3aS,5aR,5bR,7aR,9S,11aR,11bS,13aR,13bS)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	NPASS
(3S,4R,4aS,6aS,6aS,6bR,8aR,12aR,14aS,14bS)-3-hydroxy-4,4a,6a,6b,8a,11,11,14a-octamethyl-3,4,5,6,6a,7,8,9,10,12,12a,13,14,14b-tetradecahydro-1H-picen-2-one	present	NPASS
(4aR,6S,8aR)-6-[(1S)-1-hydroxyethyl]-6,8a-dihydro-4aH-pyrano[3,2-b]pyran-2-one	present	NPASS
(4aR,6S,8aS)-6-[(1S)-1-hydroxyethyl]-6,8a-dihydro-4aH-pyrano[3,2-b]pyran-2-one	present	NPASS
(4aS,6aS,6aS,6bR,8aR,12aR,14aR,14bS)-3-hydroxy-4,4a,6a,6b,8a,11,11,14a-octamethyl-5,6,6a,7,8,9,10,12,12a,13,14,14b-dodecahydro-1H-picen-2-one	present	NPASS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Typha domingensis has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes4

GenBank sequences10

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKJ474692.1 ↗234 bp

ACGT

CGCCAACGACGCTCCGCGCCCCCCGCCCGCTCGGGCGGGGCGGCGGCGGACGCGGACGATGGCCCTCCGTGCCCACGGGCACGGCGGGCT …

Typha domingensis voucher YC0518MT07 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL4rbcLaITS4

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Typha domingensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈208 223 518 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Typha domingensis0.21 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3012×CCDB · croinout · CCDB · iber-fl · CCDB · ipcn-api-dl +7

CCDB · croinout — Briggs, B. G. & Johnson, L. A. S. 1968

CCDB · croinout — Finlayson, M., R. I. Forrester, D. S. Mitchell & A. J. Chick. 1985

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).

CCDB · ipcn-api-dl — Finlayson, M., R. I. Forrester, D. S. Mitchell & A. J. Chick. 1985. Identification of native Typha species in Australia. Austral. J. Bot. 33: 101–107.

CCDB · book-ipcn67-71 — BRIGGS, B.G., & L.A.S. JOHNSON. 1968. The status and relationships of the Australasian species of ~ Contr. New South Wales Natl. Herb. 4: 57-69.

CCDB · book-northern-plants — Levan (L. & L. 1942 b). Lohammar (L. & L. 1942 b).

CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1973. Cytotaxonomy of Spanish plants. Monocotyledons. Lagascalia 3: 14 7-182. I

CCDB · book-indian_vol2 — Harada, I. 1949 ; Gunguly, B. 1959

CCDB · eflora

CCDB · book-fedorov — Harada 1949a

CCDB · book-atlas-flowering-plants — Harada 1947

n 152×CCDB · croinout · CCDB · book-ipcn67-71

CCDB · croinout — Smith, S. G. 1967

CCDB · book-ipcn67-71 — SMITH, s. G. 1967. Experimental and natural hybrids in North American~ (Typhaceae). Am. Midl. Nat. 78: 257-287.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type19 751 records

Wild obs. + sensor13 987

Museum / vouchered5 386

Cultivated / captive1

Other377

Origin

Native3 616

Introduced47

Range

Area of Occupancy AOO40 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 5 885≤1 km 2 896≤10 km 2 421>10 km 224

11 426 georeferenced · 2 561 without coordinates

Open the mapobservation + sensor13 987

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 1 026≤1 km 766≤10 km 712>10 km 118

2 622 georeferenced · 2 764 without coordinates

Open the institutions mapphysical evidence5 386

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions174 of 341 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CICYTEXlocation not on record	281
Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record	272
Mexico City, MX	196
San Diego, US	194
Saint Louis, US	184
Durango, MX	182
Adelaide, AU	174
Wuzhou, CN	158
Claremont, US	152
ASUlocation not on record	108
Canberra, AU	104
Mount Annan, AU	101
Palmerston, AU	98
MAlocation not on record	93
Chicago, US	89
Santa Barbara, US	89
Bronx, US	88
Riverside, US	87
Austin, US	82
Museo Entomologico de Leonlocation not on record	81
Brisbane, AU	75
Kensington, AU	69
Tampa, US	64
Flagstaff, US	57
Phoenix, US	52
Fort Worth, US	48
National Biodiversity Institute, Costa Ricalocation not on record	40
San Luis Obispo, US	39
LDlocation not on record	39
Albuquerque, US	37
Kew, GB	36
Córdoba, AR	35
Blumenau, BR	33
Fukushima Universitylocation not on record	32
Mérida, MX	32
Odawara, JP	32
US	31
Akita Prefectural Museumlocation not on record	30
San Jose State University, Museum of Birds and Mammalslocation not on record	30
Laboratorio de Ictiologialocation not on record	30
Ann Arbor, US	26
Nagano City, JP	26
EL PASO, US	26
Feira de Santana, BR	25
UNIVASFlocation not on record	24
University of Stellenboschlocation not on record	24
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	20
Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record	19
Bangkok, TH	19
Davis, US	19
Tokushima, JP	18
Toyama, JP	18
UFESlocation not on record	17
Salvador, BR	17
Hobart, AU	17
Universidad Juárez Autónoma de Tabascolocation not on record	17
València, ES	17
Université de Bordeauxlocation not on record	16
Corrientes, AR	16
Tsukuba, JP	16
Ciudad de México, MX	16
Chaguaramas, TT	16
CJBGlocation not on record	16
Federal University of Espírito Santolocation not on record	16
Irvine, US	15
Denver, US	15
Moscow State Universitylocation not on record	15
Miami, US	15
Museo Nacional de Costa Rica (MNCR)location not on record	15
Shinshu Universitylocation not on record	15
Plocation not on record	14
Texas Lutheran Universitylocation not on record	14
UFMSlocation not on record	14
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	14
Altos de Pipe, VE	14
US	14
Lubbock, US	14
Entomological Society of Latvialocation not on record	13
San Francisco de Campeche, MX	13
Ciudad de México, MX	12
BAYLUlocation not on record	12
Masindi, UG	12
Kochi, JP	12
Cenargenlocation not on record	11
Brasília, BR	11
Provo, US	11
Tuscaloosa, US	11
UFBAlocation not on record	11
Tlalnepantla, MX	11
JBRJlocation not on record	10
DOI/NPS, Colonial National Historical Parklocation not on record	10
Tomioka, JP	10
Los Angeles, US	10
Zapopan, MX	10
Long Beach, US	10
Logan, US	9
Severin-McDaniel Insect Collectionlocation not on record	9
San Angelo, US	9
Smithfield, AU	9
Universidade Federale do Rio Grande do Sullocation not on record	9
La Paz, MX	9
BClocation not on record	9
Edinburgh, GB	8
Guasave, MX	8
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
WTUlocation not on record	8
Berlin, DE	8
Valdosta State Universitylocation not on record	8
Canadian Department of Agriculturelocation not on record	8
Paris, FR	8
Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record	8
Departamento de Sistematica e Ecologialocation not on record	7
Istituto Agrario Castelnuovolocation not on record	7
Juriquilla, MX	7
University of Southern Mississippilocation not on record	7
Chongqing Museumlocation not on record	7
UNESClocation not on record	7
Bando, JP	7
Angwin, US	7
León, NI	6
Sendai, JP	6
Granada, ES	6
Culiacán, MX	6
GMBAlocation not on record	6
Stockholm, SE	6
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	6
Kawasaki Shi Tama Ku, JP	6
Fayetteville, US	6
CASlocation not on record	6
Frankfurt am Main	6
Universidade Federal de Sergipe (UFS)location not on record	6
Iwate Prefectural Museumlocation not on record	6
UNICAMPlocation not on record	6
St. Augustine, TT	6
UFMGlocation not on record	6
HUENFlocation not on record	6
Musee des Dinosaures d'Esperaza (Aude)location not on record	5
Ivano-Frankivsk, UA	5
Castelar, AR	5
GAlocation not on record	5
Paleontological Collectionlocation not on record	5
Tapachula, MX	5
CEPLAClocation not on record	5
Xiamen, CN	5
MeiseBGlocation not on record	5
Université de Strasbourglocation not on record	5
Santa Cruz de la Sierra, BO	5
Minia, EG	5
UFSClocation not on record	5
Pittsburg, US	5
Armidale, AU	5
UTFPR-CPlocation not on record	4
Henderson, US	4
Pretoria, ZA	4
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Sagamihara, JP	4
Aarhus, DK	4
Glocation not on record	4
Hokkaido University Museumlocation not on record	4
BGPAlocation not on record	4
Criciúma, BR	4
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	4
Ilhéus, BR	4
INMAlocation not on record	4
Mérida, MX	4
CPATSAlocation not on record	4
John T. Waterhouse Herbariumlocation not on record	4
Chadron, US	4
J.F.Oberlin Universitylocation not on record	4
Universidade Federal do Ceara, Departamento de Biologialocation not on record	3
Pullman, US	3
UFPElocation not on record	3
Stephenville, US	3
Instituto de Investigação Científica Tropicallocation not on record	3
Hermosillo, MX	3
Campo Mourão, BR	3
College Park, US	3
WAGlocation not on record	3
Universidad Nacional Agrarialocation not on record	3
Bloomington, US	3
Burlington, US	3
Institut Botanique Ake-Assi d'Andokoilocation not on record	3
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	3
Ensenada, MX	3
Henderson State Universitylocation not on record	3
HNBlocation not on record	3
GB	3
Taipei, TW	3
Jackson, US	3
Coimbra, PT	3
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record	3
Kagoshima, JP	3
Autlán de Navarro, MX	3
Chapingo, MX	3
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	3
San José, CR	3
JP	3
Catalina Island Conservancylocation not on record	3
TAFORI-LSRClocation not on record	3
Denton, US	3
Foz do Iguaçu, BR	3
Pondicherry, IN	3
IPA/SPlocation not on record	2
IAPlocation not on record	2
Fortaleza, BR	2
Arizona State University Biocollectionslocation not on record	2
Universidade de Passo Fundolocation not on record	2
Eastern Nevada Landscape Coalitionlocation not on record	2
Calabar, NG	2
Austin, US	2
UNITINSlocation not on record	2
Universidad Nacional de Asunciónlocation not on record	2
Williamsburg, US	2
Arizona Western Collegelocation not on record	2
Orem, US	2
US	2
Wollongong, AU	2
Grand Junction, US	2
Universidade Federal do Rio Grande do Nortelocation not on record	2
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	2
Durham, US	2
BMlocation not on record	2
James Cook Townsvillelocation not on record	2
Giardini Botanici Hanburylocation not on record	2
UERJlocation not on record	2
PUC-RSlocation not on record	2
Guatemala City, GT	2
Weber State Universitylocation not on record	2
Honolulu, US	2
UFPRlocation not on record	2
Mexico City, MX	2
Knoxville, US	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Columbia, US	2
UIBlocation not on record	2
KOMlocation not on record	2
Little Rock, US	2
Sevilla, ES	2
James F. Matthews Center for Biodiversity Studieslocation not on record	2
Sangmiung Universitylocation not on record	2
Cambridge, US	2
Brasília, BR	2
Jena Microbial Resource Collectionlocation not on record	2
UnBlocation not on record	2
FUVATESlocation not on record	1
LGlocation not on record	1
BFLlocation not on record	1
San Bernardino, US	1
Montecillo, Texcoco, MX	1
Conway, US	1
University of South Carolina Salkehatchielocation not on record	1
UEMAlocation not on record	1
RJBJCIlocation not on record	1
UNESP-IBILCElocation not on record	1
UNISANTAlocation not on record	1
Museum of the Rockieslocation not on record	1
Rishon Le Zion, IL	1
UEMlocation not on record	1
University of North Carolina at Pembrokelocation not on record	1
USONlocation not on record	1
LBVlocation not on record	1
Provincia di Livornolocation not on record	1
Centre National des Semences Forestièreslocation not on record	1
USFSlocation not on record	1
Toyota city nature sanctuarylocation not on record	1
Tall Timbers Research Stationlocation not on record	1
Montpellier, FR	1
Mazatlán, MX	1
Herbario Universidad de Concepciónlocation not on record	1
San Luis Potosí, MX	1
Universidad Católica de Oriente (UCO)location not on record	1
Lincoln, US	1
Nishihara, JP	1
Corvallis, US	1
OTSlocation not on record	1
San Isidro, AR	1
Seropédica, BR	1
Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record	1
Buenos Aires, AR	1
Pontifícia Universidade Católica do Paranálocation not on record	1
Norfolk, US	1
Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record	1
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	1
Herbier National du Gabonlocation not on record	1
Londrina, BR	1
UFAClocation not on record	1
Columbus State University Herbariumlocation not on record	1
Arcata, US	1
QVMAGlocation not on record	1
Russellville, US	1
FPMZBlocation not on record	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
Universidad de los Andes (UniAndes)location not on record	1
Moscow, US	1
Edmonton, CA	1
Due West, US	1
Dekalb, US	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
San Francisco, US	1
UESBlocation not on record	1
IPHAMETRAlocation not on record	1
Managua, NI	1
University of Hargeisalocation not on record	1
Mexico City, MX	1
Seychelles National Herbariumlocation not on record	1
Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record	1
Addis Ababa, ET	1
Tuxtla Gutiérrez, MX	1
Museo Achille Folettolocation not on record	1
Taipei, TW	1
Chapel Hill, US	1
Cuiabá, BR	1
Fullerton, US	1
Cape Town, ZA	1
Universidade da Região de Joinville - Univillelocation not on record	1
Durban, ZA	1
Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
MEXUlocation not on record	1
Longwood Gardenslocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
UFRRJlocation not on record	1
Bureau of Land Managementlocation not on record	1
Badajoz, ES	1
Universidad Distrital Francisco José de Caldas (UDistrital)location not on record	1
UTPLlocation not on record	1
Universidad de Antioquia (UdeA)location not on record	1
McWane Science Centerlocation not on record	1
Cochabamba, BO	1
The University of Arizonalocation not on record	1
Millersville, US	1
Arusha, TZ	1
HACAMlocation not on record	1
Salamanca, ES	1
Gump Stationlocation not on record	1
Universidade Federal de Santa Catarinalocation not on record	1
Jataí / Setor Industrial, BR	1
UNIVILLElocation not on record	1
Museo naturalistico del Frignano Ferruccio Minghellilocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1

341 institutions · 5 223 of 5 386 vouchered records shown · 161 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Typha domingensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

Riparian with Platanus racemosa, Quercus agr…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.1–22.5

Seasonal swing summer↔winter15.3 °C

Max temp (day)20.5 °C 20.3–27.7

Min temp (night)10.4 °C 9.90–18.6

Precipitation70.4 mm/mo 8.60–129

Air humidity57.7 % 49.3–63.0

Moisture balance-28.0 mm/mo -119–-17.0

Vapour deficit804 Pa 722–1,162

Wind speed2.90 m/s 2.60–4.70

Cloud cover31.7 % 19.4–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources14 archives

Size & morphology21

Life cycle & reproduction13

Diet & foraging1

Habitat & environment13

Physiology & chemistry5

Other traits3

Compound class profile5 classes

Documented compounds79 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type19 751 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions174 of 341 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type19 751 records