Typha capensis

(Rohrb.) N.E.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Typhaceae/Typha

At a glance

Occurrence records2 086

Data sources8

Biological traits18

DNA specimens9

eDNA detections5

Sources8 archives

Databases and archives Typha capensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 086 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS18 compounds

Occurrence & distributionGBIF2 086 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Typha capensis, ou massette du Cap, est une espèce de plante du genre Typha et de la famille des typhacées qui croît de l'Afrique du Sud à l'Ouganda.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height max2 m

Seed mass0.112 mg

Seed mass max0.11 mg

Seed mass min0.11 mg

Life cycle & reproduction3

Life formhelophyte

Life spanperennial

Lifeform raunkiaer detailedhelophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 950 m

Elevation min3 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTswamps, dams and rivers

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition18 compounds

Compounds documented for Typha capensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavan-3-ols4

Cholestane steroids $ Ergostane steroids4

Phthalide derivatives3

Kavalactones and derivatives2

Ursane and Taraxastane triterpenoids2

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Epiafzelechin	present	LOTUS
(1R,2R,5R,6R,9R,10R,13S,15R)-5-[(E,2R,5R)-5,6-dimethylhept-3-en-2-yl]-6,10-dimethyl-16,17-dioxapentacyclo[13.2.2.01,9.02,6.010,15]nonadec-18-en-13-ol	present	LOTUS
(3R)-3-benzyl-7-hydroxy-3H-2-benzofuran-1-one	present	LOTUS
(3R)-8-hydroxy-3-[(E)-2-phenylethenyl]-3,4-dihydroisochromen-1-one	present	LOTUS
(3S)-3-benzyl-7-hydroxy-3H-2-benzofuran-1-one	present	LOTUS
(3S,4aR,6aR,6aR,6bR,8aR,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-ol	present	LOTUS
(3S,4S,5S,9R,10S,13R,14R,17R)-4,10,13-trimethyl-17-[(2S)-6-methyl-5-methylideneheptan-2-yl]-2,3,4,5,6,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
3-benzyl-7-hydroxy-3H-2-benzofuran-1-one	present	LOTUS
5-O-Caffeoylshikimic acid	present	LOTUS
8-hydroxy-3-[(E)-2-phenylethenyl]-3,4-dihydroisochromen-1-one	present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Typha capensis has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJQ025102.1 ↗552 bpSouth Africa · 2010

ACGT

AGTGCTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATACGAAACCAAGGATACTGATATCTTGGCAGCA …

Typha capensis voucher LTM031 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL2★rbcLa

plant barcode

08Occurrence & distribution

Record type2 086 records

Wild obs. + sensor1 825

Museum / vouchered261

Range

Area of Occupancy AOO4 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 364≤1 km 172≤10 km 38>10 km 19

1 593 georeferenced · 232 without coordinates

Open the mapobservation + sensor1 825

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤1 km 4≤10 km 3

7 georeferenced · 254 without coordinates

Open the institutions mapphysical evidence261

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	140
Durban, ZA	29
MeiseBGlocation not on record	28
Cape Town, ZA	15
Bronx, US	7
Saint Louis, US	6
Kew, GB	3
University of Stellenboschlocation not on record	3
LNBG$location not on record	3
University of Johannesburglocation not on record	2
Claremont, US	2
US	2
South Kensington, GB	2
Moscow State Universitylocation not on record	1
TAFORI-LSRClocation not on record	1
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
Berlin, DE	1
MSB-3054location not on record	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1

19 institutions · 248 of 261 vouchered records shown · 13 without an institution code

09Environmental DNA5 detections

Where the DNA of Typha capensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 16.7–19.6

Seasonal swing summer↔winter11.2 °C

Max temp (day)23.5 °C 22.7–26.1

Min temp (night)11.6 °C 10.6–12.8

Precipitation58.9 mm/mo 53.8–62.3

Air humidity52.3 % 50.4–53.4

Moisture balance-66.6 mm/mo -82.3–-55.1

Vapour deficit977 Pa 895–1,135

Wind speed2.10 m/s 1.70–2.80

Cloud cover18.9 % 17.2–19.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Typha capensis

At a glance

Sources8 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

Compound class profile5 classes

Documented compounds18 total

At a glance

Record type2 086 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 086 records