Typha angustifolia
speciesAt a glance
Occurrence records105 296
Data sources16
Biological traits134
DNA specimens49
eDNA detections43
Sources16 archives
Databases and archives Typha angustifolia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility105 296 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics49 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources134 traits
Chemical compositionFooDB · LOTUS · NPASS5 652 compounds
Occurrence & distributionGBIF105 296 records
Environmental DNA2 datasets · 7 countries43 detections
DNA & barcodingBOLD · NCBI49 specimens
Genome at a glanceCCDB · GoaT · NCBI313 Mbp
01Narrative
La Massette à feuilles étroites, appelée aussi Roseau à massette ou Quenouille à feuilles étroites au Canada, est une plante de la famille des Typhaceae. Après Typha latifolia, c'est la plus commune du genre Typha. C'est une plante herbacée pérenne qui pousse dans les régions tempérées et tropicales de l'hémisphère nord. Elle comprend un rhizome stolonifère submergé et peut supporter des eaux légèrement saumâtres. La plante peut mesurer entre 1 et 3 m de haut, elle possède des feuilles alternes étroites de 3 à 10 mm, vert franc. L'inflorescence est formée de deux épis superposés espacés de 2 à 8 cm. L'épi mâle, au-dessus, est garni de poils roux plus longs que les étamines, tandis que l'épi femelle est cylindrique et grêle, brun-fauve. C'est une plante utile, entre autres, pour des mammifères semi-aquatiques.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology19
Fruit length1.5 mm
Fruit length max1.5 mm
Fruit length min1.5 mm
Leaf length870 mm
Leaf length max1 200 mm
Leaf length min540 mm
Leaf mass1 540 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 9 562 mm² · GIFT: 9 562 mm²
Leaf width6.5 mm
Leaf width max9 mm
Leaf width min4 mm
Plant height1.67 m
⚠ sources differ — GIFT: 1.67 m · LEDA: 1.5 m · USDA: 1.49 m · TRY: 2.19 m
Plant height generative1.5 m
Plant height max3 m
Plant height min1 m
Seed length1 mm
Seed mass0.092 mg
⚠ sources differ — TRY: 0.092 mg · LEDA: 0.04 mg · GIFT: 0.133 mg
Seed mass max0.31 mg
Seed mass min0.039 mg
Life cycle & reproduction36
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flower colourgreen
Flower conspicuousYes
Flowering endAug
Flowering startJun
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formhelophyte
Life spanperennial
Lifespan categoryLong
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: cryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number360 000
Seed spread rateRapid
Seedling vigorMedium
Self fertilizationabsent
Sex typemonoecious
Vegetative spread rateRapid
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment29
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 100 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourwhite
Fruit typeachene
Growth formherb
Growth form USDARhizomatous
Habitat GIFTÁrea Antrópica, Restinga, Vegetação Aquática
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min10 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min130 days
Leaf C:N ratio14.53 g/g
Leaf c420 mg/g
Leaf dry-matter content (LDMC)252 mg/g
⚠ sources differ — TRY: 252 mg/g · LEDA: 266 mg/g
Leaf n19.7 mg/g
Leaf p1.44 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min30 in
Protein potentialLow
Salinity toleranceMedium
Seed longevity index0.5
Shade toleranceHigh
Soil pH max8.5 pH
Soil pH min3.7 pH
Specific leaf area (SLA)8.27 mm²/mg
⚠ sources differ — TRY: 8.27 mm²/mg · LEDA: 6.6 mm²/mg · GIFT: 6.58 mm²/mg
Temperature min-33 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanYes
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Diaspore typegerminule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceYes
Planting density max3 700 per acre
Planting density min2 728 per acre
03Chemical composition5 652 compounds
Compounds documented for Typha angustifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingVegetables
Compound class profile5 classes
Aminoacids67
Glycerophospholipids57
Cinnamic acids and derivatives30
Purine nucleos(t)ides29
Monosaccharides25
Documented compounds5 652 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Potassium | 309 mg/100g | FooDB | |
| Sugars | 220 mg/100g | FooDB | |
| Sodium | 109 mg/100g | FooDB | |
| D-Mannose | 70 mg/100g | FooDB | |
| Sucrose | 70 mg/100g | FooDB | |
| D-Fructose | 70 mg/100g | FooDB | |
| Calcium | 54 mg/100g | FooDB | |
| Phosphorus | 45 mg/100g | FooDB | |
| Choline | 23.7 mg/100g | FooDB | |
| Retinol | 11 IU | FooDB |
05DNA & barcoding49 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Typha angustifolia has left across the world's sequence archives.
At a glance
DNA specimens49
Marker genes6
GenBank sequences10
eDNA detections43
Countries7
The DNA barcodea real sequence read deposited for this species
GTCGTCCCTCTCGCCCTCGGGCGCGGGGCGACGGGCGGGGCACGGACGAACCCCGGCGCGACTTTGGCGCCAAGGAACACAAGAGACGGA …
Typha angustifolia isolate F0157 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL8★rbcLa★trnL-F★ITS1
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Typha angustifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size312 960 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Typha angustifolia0.31 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 30 n = 15
Ploidy2× diploid · measured
Chromosome records30–602n range30median30mode29records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3026×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · poland +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · poland — Skali?ska M., Pogan E. et al. 1966. Further studies in chromosome numbers of Polish Angiosperms. Sixth contribution. Acta Biol. Cracov. Ser. Bot. 9, 31-58.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981b. In Chromosome number reports LXXII. Taxon 30: 699–701.
CCDB · book-ipcn66 — Skalinska et al. 1966
CCDB · book-ipcn75-78 — Murin & Vachova 1976
CCDB · book-ipcn75-78 — Labadie 1976a
CCDB · eflora
CCDB · book-fedorov — Levan (LOve A., Love D. 1942b)
CCDB · book-fedorov — Lohammar (LOve A., LOve D. 1942b)
CCDB · book-fedorov — Tarnavschi 1948
CCDB · book-fedorov — Reese 1957
CCDB · book-fedorov — LOve A., Love D. 1961b
CCDB · book-fedorov — Gadella, Kliphuis 1963
CCDB · book-fedorov — Pogan (Skalinska et al. 1966)
CCDB · book-atlas-flowering-plants — L. & L. 1942
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1963). Chromosome numbers of flowering plants in the Netherlands. Acta Bot. Neerl. 12(2): 195-230.
CCDB · CromoCat 2015 — Hindakova, M. (1976). Index of chromosome numbers of Slovakian flora. (Part 5). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1-18.
CCDB · CromoCat 2015 — Labadie, J. P. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 636-639.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1981c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 699-701.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Reese, G. (1957). Über die Polyploidiespektren in der nordsaharischen Wüstenpflanzen. Flora 144: 598-634.
CCDB · CromoCat 2015 — Tarnavschi, I. T. (1948). Die chromosomenzahlen der Anthophyten flora von Rumänien mit einem ausblick auf das Polyploidie problem. Bull. Jard. Mus. Bot. Univ. Cluj. 28: 1-130.
2n 603×CCDB · book-fedorov
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — Heiser, Whitaker 1948
n 152×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — SMITH, s. G. 1967. Experimental and natural hybrids in North American~ (Typhaceae). Am. Midl. Nat. 78: 257-287.
CCDB · CromoCat 2015 — Smith, S. G. (1967). Experimental and natural hybrids in North American Typha (Typhaceae). Amer. Midl. Naturalist 78: 257-287.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelComplete Genome
08Occurrence & distribution
Record type105 296 records
Wild obs. + sensor93 196
Museum / vouchered8 009
Cultivated / captive45
Other4 046
Origin
Native2 056
Introduced51
Range
Area of Occupancy AOO168 388 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy51% within 1 km
≤100 m 25 917≤1 km 11 577≤10 km 35 513>10 km 926
73 933 georeferenced · 19 263 without coordinates
Open the mapobservation + sensor93 196
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 366≤1 km 1 444≤10 km 2 350>10 km 623
4 783 georeferenced · 3 226 without coordinates
Open the institutions mapphysical evidence8 009
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy2% within 1 km
≤1 km 1≤10 km 26>10 km 17
44 georeferenced · 1 without coordinates
Open the mapnot free-living45
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions212 of 375 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 630 |
| Helsinki, FI | 368 |
| BIO-UNIPIlocation not on record | 280 |
| LDlocation not on record | 209 |
| Moscow State Universitylocation not on record | 184 |
| BFLlocation not on record | 167 |
| Madison, US | 150 |
| Uppsala, SE | 149 |
| Wuzhou, CN | 135 |
| St. Paul, US | 129 |
| Oregon State Universitylocation not on record | 124 |
| Philadelphia, US | 113 |
| Chongqing Museumlocation not on record | 108 |
| Olocation not on record | 106 |
| Sanda, JP | 96 |
| Bronx, US | 91 |
| MeiseBGlocation not on record | 90 |
| Université Lavallocation not on record | 79 |
| Turku, FI | 68 |
| Tartu, EE | 66 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 62 |
| Beijing, CN | 59 |
| SLU Artdatabankenlocation not on record | 55 |
| Chicago, US | 51 |
| Wlocation not on record | 45 |
| Oskarshamn, SE | 44 |
| University of Stellenboschlocation not on record | 43 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 41 |
| Ann Arbor, US | 40 |
| College Park, US | 40 |
| Adam Mickiewicz University in Poznańlocation not on record | 39 |
| Bando, JP | 38 |
| Williamsburg, US | 37 |
| Chadron, US | 37 |
| Bangkok, TH | 37 |
| Chiba, JP | 36 |
| Bergen, NO | 36 |
| Denver, US | 36 |
| WINlocation not on record | 36 |
| Saint Louis, US | 36 |
| Bloomington, US | 35 |
| University of New Hampshirelocation not on record | 35 |
| University of Wisconsinlocation not on record | 34 |
| Uniwersytet Warszawskilocation not on record | 33 |
| València, ES | 33 |
| Odawara, JP | 33 |
| Museum of the Rockieslocation not on record | 32 |
| Oulu, FI | 32 |
| Bern, CH | 31 |
| Nanjing, CN | 31 |
| Green Bay, US | 30 |
| Québec, CA | 30 |
| CICYTEXlocation not on record | 30 |
| Guangzhou, CN | 29 |
| Kuopio, FI | 29 |
| Acadia Universitylocation not on record | 28 |
| Chapel Hill, US | 27 |
| WTUlocation not on record | 27 |
| International Salmonella Centre (W.H.O.)location not on record | 26 |
| KMNlocation not on record | 26 |
| Burlington, US | 26 |
| IFR-DNFlocation not on record | 23 |
| Toronto, CA | 21 |
| Dresden, DE | 20 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 18 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 18 |
| South Kensington, GB | 18 |
| DOI/NPS, Greenbelt Parklocation not on record | 17 |
| Berlin, DE | 17 |
| Montréal, CA | 17 |
| Ciudad de México, MX | 17 |
| LfUlocation not on record | 17 |
| McWane Science Centerlocation not on record | 17 |
| TUR-Alocation not on record | 16 |
| Pullman, US | 15 |
| Kochi, JP | 15 |
| Frankfurt am Main | 15 |
| BDBClocation not on record | 15 |
| CJBGlocation not on record | 15 |
| GJOlocation not on record | 14 |
| Tallinn, EE | 14 |
| Riverside, US | 14 |
| Yangling, CN | 14 |
| Norfolk, US | 14 |
| Trondheim, NO | 13 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 13 |
| Taipei, TW | 13 |
| National Institute of Biological Resourceslocation not on record | 13 |
| Provincia di Livornolocation not on record | 13 |
| Fort Worth, US | 13 |
| Taipei, TW | 13 |
| Görlitz, DE | 13 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| Chicago, US | 12 |
| Jyväskylä, FI | 12 |
| Irkutsk State Universitylocation not on record | 12 |
| Auckland, NZ | 12 |
| Saint John, CA | 12 |
| Santa Barbara, US | 12 |
| Canadian Department of Agriculturelocation not on record | 11 |
| Spearfish, US | 11 |
| Corvallis, US | 11 |
| DBF-NHMDlocation not on record | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| KIWElocation not on record | 11 |
| HUFDlocation not on record | 11 |
| Austin, US | 11 |
| MAlocation not on record | 11 |
| Davis, US | 10 |
| Kunming, CN | 10 |
| Claremont, US | 10 |
| Zürich, CH | 9 |
| Pittsburg, US | 9 |
| Mount Pleasant, US | 9 |
| Knoxville, US | 9 |
| Vancouver, CA | 9 |
| Durango, MX | 9 |
| Salamanca, ES | 9 |
| Staten Island, US | 9 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 9 |
| NSMKlocation not on record | 8 |
| KR | 8 |
| Montréal, CA | 8 |
| Lincoln, US | 8 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 8 |
| TAIElocation not on record | 8 |
| BClocation not on record | 8 |
| San Diego, US | 7 |
| US | 7 |
| Allentown, US | 7 |
| Paris, FR | 7 |
| Dekalb, US | 7 |
| Henderson State Universitylocation not on record | 7 |
| University of Guelph, OAC Herbariumlocation not on record | 7 |
| Minia, EG | 7 |
| New Haven, US | 7 |
| Flagstaff, US | 7 |
| Philadelphia, US | 7 |
| Whitewater, US | 7 |
| Angwin, US | 7 |
| Jackson, US | 7 |
| BRNUlocation not on record | 7 |
| Zürich, CH | 7 |
| GZUlocation not on record | 7 |
| Badajoz, ES | 7 |
| Salzburg, AT | 7 |
| Ypsilanti, US | 7 |
| Barcelona, ES | 6 |
| Guilin, CN | 6 |
| Universidad de Caldas (UCaldas)location not on record | 6 |
| Armidale, AU | 6 |
| Urumqi, CN | 6 |
| EL PASO, US | 6 |
| Madrid, ES | 6 |
| Phoenix, US | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Chengdu, CN | 6 |
| Pamplona, ES | 6 |
| Juriquilla, MX | 5 |
| Granada, ES | 5 |
| San Luis Obispo, US | 5 |
| Tuxtla Gutiérrez, MX | 5 |
| Porrentruy, CH | 5 |
| Washington, US | 5 |
| Wuhan, CN | 5 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 5 |
| Jiangxi College of Educationlocation not on record | 5 |
| Ishikawa Museum of Natural Historylocation not on record | 5 |
| Campo Mourão, BR | 5 |
| Baroda, IN | 5 |
| Boise, US | 5 |
| Millersville, US | 4 |
| Canberra, AU | 4 |
| Keene State Universitylocation not on record | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| SZUlocation not on record | 4 |
| Waverly, US | 4 |
| University of Winnipeglocation not on record | 4 |
| BAYLUlocation not on record | 4 |
| China Agricultural Universitylocation not on record | 4 |
| GAlocation not on record | 4 |
| Xian, CN | 4 |
| UTFPR-CPlocation not on record | 4 |
| JBSlocation not on record | 4 |
| St. Augustine, TT | 4 |
| Caldwell, US | 4 |
| Miami, US | 4 |
| Jiujiang Forestry Institutelocation not on record | 4 |
| Bourges, FR | 4 |
| Alicante, ES | 4 |
| Xiamen, CN | 4 |
| Brookings, US | 4 |
| Stockholm, SE | 4 |
| Kew, GB | 4 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 3 |
| Hudson, US | 3 |
| Mlocation not on record | 3 |
| Porvoo, FI | 3 |
| Pocatello, US | 3 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 3 |
| Strecker Museum, Baylor Universitylocation not on record | 3 |
| Lubbock, US | 3 |
| Tilburg, NL | 3 |
| ASUlocation not on record | 3 |
| University of Tennessee at Chattanoogalocation not on record | 3 |
| Sevilla, ES | 3 |
| Federal University of Espírito Santolocation not on record | 3 |
| Henderson, US | 3 |
| UFESlocation not on record | 3 |
| INMAlocation not on record | 3 |
| Forssa, FI | 3 |
| ZRC-SAZUlocation not on record | 3 |
| Zhengzhou, CN | 3 |
| Columbia, US | 3 |
| Tampa, US | 3 |
| US | 3 |
| Arcata, US | 3 |
| San Angelo, US | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| University of Southern Mississippilocation not on record | 3 |
| Emporia, US | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Conway, US | 2 |
| VALElocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Fairfax, US | 2 |
| Hazara Universitylocation not on record | 2 |
| San Bernardino, US | 2 |
| Provo, US | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Durham, US | 2 |
| Logan, US | 2 |
| Kirksville, US | 2 |
| Moscow, US | 2 |
| Mexico City, MX | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Missoula, US | 2 |
| Frauenfeld, CH | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| Taipei, TW | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| Irvine, US | 2 |
| Lanzhou, CN | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| KURAlocation not on record | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| Richmond, US | 2 |
| PRClocation not on record | 2 |
| UGentlocation not on record | 2 |
| Macomb, US | 2 |
| Tempe, US | 2 |
| Salvador, BR | 2 |
| Albuquerque, US | 2 |
| Chicago, US | 2 |
| National Museum Waleslocation not on record | 2 |
| IECOSlocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Trois-Rivières, CA | 2 |
| Philadelphia, US | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Bozeman, US | 2 |
| Ivano-Frankove, UA | 2 |
| Fargo, US | 2 |
| TROMlocation not on record | 2 |
| Hobart, AU | 2 |
| Chengdu, CN | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Cascavel, BR | 2 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Mérida, MX | 1 |
| PHlocation not on record | 1 |
| Springfield, US | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| University of Central Missourilocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Pamplona, ES | 1 |
| Shenzhen, CN | 1 |
| Santiago de Cali, CO | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Los Angeles, US | 1 |
| South China Normal Universitylocation not on record | 1 |
| Changsha, CN | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Clemson, US | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Namur, BE | 1 |
| Honolulu, US | 1 |
| Córdoba, AR | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| INFlocation not on record | 1 |
| Morgantown, US | 1 |
| Oswego, US | 1 |
| Baltimore, US | 1 |
| Tacoma, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Denton, US | 1 |
| Sion, CH | 1 |
| Fribourg, CH | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Rovaniemi, FI | 1 |
| Wellington, NZ | 1 |
| CASlocation not on record | 1 |
| Edmonton, CA | 1 |
| New Brunswick, US | 1 |
| UNIVASFlocation not on record | 1 |
| Chaguaramas, TT | 1 |
| UESBlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Banyoles, ES | 1 |
| Fulda, DE | 1 |
| US | 1 |
| Altos de Pipe, VE | 1 |
| KNAMlocation not on record | 1 |
| JMSlocation not on record | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Lanzhou Institute of Desert Research, Academia Sinicalocation not on record | 1 |
| Firenze, IT | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Jefferson City, US | 1 |
| Durango, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Edinburgh, GB | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| BGPAlocation not on record | 1 |
| LPMMBHlocation not on record | 1 |
| Aarhus, DK | 1 |
| Winterthur, CH | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| SJNAlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| San Jose, US | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Northridge, US | 1 |
| Awka, NG | 1 |
| University of Wisconsinlocation not on record | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Long Beach, US | 1 |
| BSBIlocation not on record | 1 |
| Bothell, US | 1 |
| H-AkrKGlocation not on record | 1 |
| No collectionlocation not on record | 1 |
| Walla Walla, US | 1 |
| Hamilton, US | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Mexico City, MX | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| UFSMlocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Nijmegen, NL | 1 |
| Portland, US | 1 |
| UFPElocation not on record | 1 |
| Little Rock, US | 1 |
| FLASlocation not on record | 1 |
375 institutions · 7 336 of 8 009 vouchered records shown · 635 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA43 detections
Where the DNA of Typha angustifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found43
Studies independent surveys2
Countries7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 43 detections have coordinates
Open the map7 countries0
bogAquatic-pondsCoastal Area
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature21.5 °C 18.0–21.9
pH7.08 6.79–8.27
Conductivity40,100 µS/cm
Salinity29.7 PSU 29.0–30.1
Turbidity2.45 NTU 1.90–3.00
Depth0 m 0–1.00
SedimentCoastal water
7 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.6 °C 12.5–22.0
Seasonal swing summer↔winter21.6 °C
Max temp (day)21.8 °C 16.3–24.6
Min temp (night)13.8 °C 8.00–20.2
Precipitation82.6 mm/mo 24.6–118
Air humidity60.2 % 47.8–63.5
Moisture balance-40.8 mm/mo -73.9–23.7
Vapour deficit895 Pa 580–997
Wind speed3.60 m/s 2.60–6.00
Cloud cover45.3 % 23.7–59.2
CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.