Tylosema esculentum

(Burch.) A.Schreib. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Tylosema

At a glance

Occurrence records200

Data sources11

Biological traits21

DNA specimens3

eDNA detections1

Sources11 archives

Databases and archives Tylosema esculentum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility200 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS24 compounds

Occurrence & distributionGBIF200 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT · NCBI≈553 Mbp

01Narrative

Tylosema esculentum, with common names gemsbok bean and marama bean or morama bean, is a long-lived perennial legume native to arid areas of southern Africa. Stems grow at least 3 metres, in a prostrate or trailing form, with forked tendrils that facilitate climbing. A raceme up to 25 mm long, containing many yellow-orange flowers, ultimately produces an ovate to circular pod, with large brownish-black seeds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height1 m

Plant height max9 m

Plant height min1.79 m

Seed mass1 288 mg

⚠ sources differ — TRY: 1 288 mg · GIFT: 2 282 mg

Seed mass max2 282 mg

Seed mass min2 282 mg

Life cycle & reproduction3

Life formscrambling tuberous geophyte

Life spanperennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 600 m

Elevation min925 m

Epiphyteterrestrial

Growth formherb

Woodinessvariable

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition24 compounds

Compounds documented for Tylosema esculentum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Quinoline alkaloids4

Unsaturated fatty acids3

Flavonols2

Quinazoline alkaloids2

Cyanogenic glycosides1

Documented compounds24 total

Tissue Source Quantified only

Compound	Amount	Source
(2Z)-2-[(4S,5R,6R)-4,5-dihydroxy-6-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycyclohex-2-en-1-ylidene]acetonitrile	present	LOTUS
(3aR,6S,7R,7aR)-6,7-dihydroxy-3a,6,7,7a-tetrahydro-3H-1-benzofuran-2-one	present	LOTUS
(6S,7R,7aR)-6,7-dihydroxy-7,7a-dihydro-6H-1-benzofuran-2-one	present	LOTUS
2-(3',4'-Dimethoxyphenylethyl)quinoline	present	NPASS
2-[(E)-2-(1,3-benzodioxol-5-yl)ethenyl]-4-methoxyquinoline	present	NPASS
2-[2-(1,3-Benzodioxol-5-Yl)Ethyl]Quinoline	present	NPASS
2-Pentylquinoline	present	NPASS
2-Phenylquinoline	present	NPASS
2-Propylquinoline	present	NPASS
4-Methoxy-2-pentylquinoline	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tylosema esculentum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAJ584710.1 ↗1 375 bpBotswana

ACGT

AAGTGTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Tylosema esculentum rbcL gene for ribulose 1,5 bisphosphate carboxylase large subunit

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL4

animal barcodeplant barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Tylosema esculentum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈553 274 936 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Tylosema esculentum0.55 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type200 records

Wild obs. + sensor73

Museum / vouchered126

Other1

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 22≤1 km 17≤10 km 5>10 km 1

45 georeferenced · 28 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 126 records without

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	106
Instituto de Investigação Científica Tropicallocation not on record	6
Kew, GB	4
Cape Town, ZA	2
Boise, US	1
Cape Town, ZA	1
LDlocation not on record	1
Uppsala, SE	1

8 institutions · 122 of 126 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Tylosema esculentum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 22.2–22.2

Seasonal swing summer↔winter11.7 °C

Max temp (day)29.1 °C

Min temp (night)14.7 °C

Precipitation31.1 mm/mo

Air humidity47.2 %

Moisture balance-121 mm/mo

Vapour deficit1,448 Pa

Wind speed3.20 m/s

Cloud cover26.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)