Tylecodon wallichii

(Harv.) Toelken · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Tylecodon

At a glance

Occurrence records276

Data sources11

Biological traits20

DNA specimens3

eDNA detections2

Sources11 archives

Databases and archives Tylecodon wallichii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility276 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF276 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Tylecodon wallichii is a species of succulent plant in the genus Tylecodon belonging to the family Crassulaceae. The species is named in honour of Nathaniel Wallich, early 19th century Danish plant hunter, botanist and physician.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max1 m

Plant height min0.3 m

Seed mass0.03 mg

Seed mass max0.03 mg

Seed mass min0.03 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Dispersal typewind

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 500 m

Elevation min50 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayCAM

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Tylecodon wallichii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Monomeric stilbenes3

Phenanthrenes3

Bufadienolides1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
2,3,5,7-Tetramethoxyphenanthrene	present	NPASS
5-(2-(2-Hydroxyphenyl)ethyl)-1,3-benzenediol	present	NPASS
5-[(1S,3R,5S,6R,9R,10R,13R,14R,16S,18R,20R,22S,24S,25R,26R)-13,25,26-trihydroxy-1-methoxy-5,9,24-trimethyl-2,15,21,23-tetraoxaheptacyclo[20.3.1.03,20.05,18.06,14.09,13.014,16]hexacosan-10-yl]pyran-2-one	present	LOTUS
Batatasin Iv	present	NPASS
Dihydropinosylvin	present	NPASS
Hircinol	present	NPASS
Isobatatasin I	present	NPASS
QSKFJIQOEAWAJW-VPTYWWQVSA-N	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tylecodon wallichii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY692314.1 ↗497 bp

ACGT

CCGCCCCCCGCTCGGCCGACACGGGGCCTCGCGCCTCGCGCCGGCCGATCCTAACGAACCCCGGCGCGGACAGCGCCAAGGAATCATAAC …

Tylecodon wallichii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tylecodon wallichii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · Oberlander2016

CCDB · Oberlander2016 — Mort et al., 2001

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.288 ↗

08Occurrence & distribution

Record type276 records

Wild obs. + sensor270

Museum / vouchered6

Range

Area of Occupancy AOO884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 159≤1 km 30≤10 km 16>10 km 20

225 georeferenced · 45 without coordinates

Open the mapobservation + sensor270

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	2
University of Johannesburglocation not on record	1
MAlocation not on record	1
PRClocation not on record	1
Saint Louis, US	1

5 institutions · 6 of 6 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Tylecodon wallichii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 14.6–14.6

Seasonal swing summer↔winter5.90 °C

Max temp (day)19.1 °C

Min temp (night)11.0 °C

Precipitation13.4 mm/mo

Air humidity58.7 %

Moisture balance-96.1 mm/mo

Vapour deficit685 Pa

Wind speed4.00 m/s

Cloud cover8.20 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)