Tylecodon paniculatus

(L.fil.) Toelken · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Tylecodon

At a glance

Occurrence records1 747

Data sources7

Biological traits20

DNA specimens7

eDNA detections4

Sources7 archives

Databases and archives Tylecodon paniculatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility1 747 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF1 747 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Tylecodon paniculatus, also known as butter bush, butter tree, butterboom or rooisuikerblom (Afrikaans), is a species of succulent plant in the genus Tylecodon belonging to the family Crassulaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max2 m

Plant height min0.5 m

Seed mass0.05 mg

Seed mass max0.06 mg

Seed mass min0.04 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Dispersal typewind

Life formsucculent shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 200 m

Elevation min50 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayCAM

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tylecodon paniculatus has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences3

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY692313.1 ↗495 bp

ACGT

CCGCCCCCCGCTCGGCCGACACGGGGCCTCGCGCCTCGCGCCGGCCGATCCTAACGAACCCCGGCGCGGACAGCGCCAAGGAATCATAAC …

Tylecodon paniculatus internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type1 747 records

Wild obs. + sensor1 667

Museum / vouchered78

Cultivated / captive2

Range

Area of Occupancy AOO3 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 162≤1 km 132≤10 km 44>10 km 84

1 422 georeferenced · 245 without coordinates

Open the mapobservation + sensor1 667

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence78

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	56
University of Johannesburglocation not on record	3
Cape Town, ZA	3
Kew, GB	3
MSB-3054location not on record	3
Zürich, CH	2
MAlocation not on record	1
South African National Biodiversity Institutelocation not on record	1
Berlin, DE	1
University of Stellenboschlocation not on record	1

10 institutions · 74 of 78 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Tylecodon paniculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 12.9–17.9

Seasonal swing summer↔winter6.40 °C

Max temp (day)19.1 °C 18.0–21.0

Min temp (night)11.0 °C 7.80–15.0

Precipitation16.8 mm/mo 14.1–33.1

Air humidity59.5 % 58.9–60.4

Moisture balance-96.1 mm/mo -158–-68.4

Vapour deficit685 Pa 605–820

Wind speed4.00 m/s 3.90–5.80

Cloud cover8.60 % 8.30–11.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tylecodon paniculatus

At a glance

Sources7 archives

Size & morphology5

Life cycle & reproduction4

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

Other traits1

At a glance

Record type1 747 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions5 of 10 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 747 records