Turricula parryi

(A.Gray) J.F.Macbr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Namaceae/Turricula

At a glance

Occurrence records197

Data sources12

Biological traits12

DNA specimens4

eDNA detections2

Sources12 archives

Databases and archives Turricula parryi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility197 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Chemical compositionLOTUS · NPASS68 compounds

Occurrence & distributionGBIF197 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Eriodictyon parryi or poodle-dog bush is a tall California mountain shrub with showy purple flowers, which is notable for secreting a severe skin irritant. It is an opportunistic species that grows mostly in areas that have been disturbed by fire. In a dry early spring in Southern California, its semi-dormant leaves can droop and curl into coils like locks of curly hair, hence the popular name based on the metaphor of a poodle's natural hair.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass0.157 mg

Seed mass max0.199 mg

Seed mass min0.13 mg

Life cycle & reproduction2

Dispersal typeunspecialized

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition68 compounds

Compounds documented for Turricula parryi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavonols53

Flavones10

Merosesquiterpenoids2

Documented compounds68 total

Tissue Source Quantified only

Compound	Amount	Source
2-(2,5-Dihydroxy-4-methoxyphenyl)-5,7-dihydroxy-6,8-dimethoxychromen-4-one	present	NPASS
2-(2,5-Dihydroxy-4-methoxyphenyl)-5,7-dihydroxy-8-methoxychromen-4-one	present	NPASS
2-(2,5-Dihydroxy-4-methoxyphenyl)-5-hydroxy-6,7,8-trimethoxychromen-4-one	present	NPASS
2-(3,4-dihydroxyphenyl)-3,5-dihydroxy-7-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]chromen-4-one	present	NPASS
2-(3,4-Dihydroxyphenyl)-5,7,8-trihydroxy-3-methoxy-4H-chromen-4-one	present	NPASS
2-(3,4-dihydroxyphenyl)-5-hydroxy-7-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]chromen-4-one	present	NPASS
3',4',5,7-Tetrahydroxy-3,8-dimethoxyflavone	present	NPASS
3,5,3',4'-Tetrahydroxy-6,7,8-trimethoxyflavone	present	NPASS
3,5,7,3',4'-Pentahydroxy-6,8-dimethoxyflavone	present	NPASS
3,5,7-Trihydroxy-2-(4-hydroxy-3-methoxyphenyl)-6,8-dimethoxy-4H-1-benzopyran-4-one	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Turricula parryi has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK161293.1 ↗666 bpUSA · 2005

ACGT

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCACAGCAGAACGACCAGCGAACCCGTTCAACTACGCGGGGTCGGGC …

Turricula parryi isolate CDA-0020541 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Turricula parryi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Cave & C. 1947

08Occurrence & distribution

Record type197 records

Wild obs. + sensor1

Museum / vouchered196

Origin

Native3

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 16≤1 km 48≤10 km 49

113 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence196

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	102
Riverside, US	43
Los Angeles, US	20
Canadian Department of Agriculturelocation not on record	11
Irvine, US	4
EL PASO, US	2
Phoenix, US	2
Tampa, US	2
San Diego, US	2
Angwin, US	2
Mexico City, MX	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Arcata, US	1
US	1
Columbia, US	1
Santa Barbara, US	1

16 institutions · 196 of 196 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Turricula parryi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Phacelia brachyloba, Gilia caruifolia, Crypt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 22.2–22.2

Seasonal swing summer↔winter14.1 °C

Max temp (day)30.1 °C

Min temp (night)16.0 °C

Precipitation6.00 mm/mo

Air humidity50.5 %

Moisture balance-166 mm/mo

Vapour deficit1,324 Pa

Wind speed1.30 m/s

Cloud cover12.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)