Turnera ulmifolia
speciesAt a glance
Occurrence records7 240
Data sources17
Biological traits48
DNA specimens13
eDNA detections10
Sources17 archives
Databases and archives Turnera ulmifolia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 237 records↗
OBISOcean Biodiversity Information System3 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics13 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources48 traits
Chemical compositionLOTUS · NPASS88 compounds
Occurrence & distributionGBIF · OBIS7 240 records
Environmental DNA1 datasets · 2 countries10 detections
DNA & barcodingBOLD · NCBI13 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 30
01Narrative
Turnera ulmifolia est une espèce de plantes à fleurs de la famille des Passifloraceae originaire d'Amérique centrale et des Caraïbes.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology20
Fruit length5.5 mm
Fruit length max8 mm
Fruit length min6 mm
Leaf length92.5 mm
Leaf length max20 mm
Leaf width31.5 mm
Leaf width max5 mm
Petiole length1.25 cm
Plant height0.8 m
⚠ sources differ — GIFT: 0.8 m · AusTraits: 1 m
Plant height max1.5 m
Plant height min0.4 m
Seed length2.5 mm
Seed length max3 mm
Seed length min2 mm
Seed mass0.959 mg
⚠ sources differ — TRY: 0.959 mg · GIFT: 0.875 mg
Seed mass max0.88 mg
Seed mass min0.87 mg
Seed volume9.2 mm³
Seed volume max9.2 mm³
Seed volume min9.2 mm³
Life cycle & reproduction10
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeanimal
Flower colouryellow
Flower width max60 mm
Flowering endAug
Flowering startMay
Life formsubshrub or shrub
Life spanperennial
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 000 m
Elevation mean100 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typecapsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb shrub · TRY: Herb
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapeelliptical ovate
Mycorrhiza type0.00000519
Woodinessnon-woody
⚠ sources differ — TRY: H · AusTraits: herbaceous woody · GIFT: non-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition88 compounds
Compounds documented for Turnera ulmifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Steroidal alkaloids7
Cyanogenic glycosides6
Cinnamic acids and derivatives5
Apotirucallane triterpenoids $ Limonoids4
Unsaturated fatty acids4
Documented compounds88 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R)-1-(beta-D-Glucopyranosyloxy)-2-cyclopentene-1-carbonitrile | present | LOTUS | |
| (1R,2R,4R,5'R,6R,7S,8R,9S,12S,13S,16S,18S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-ol | present | NPASS | |
| (1R,2R,4R,5R,8S,11R,13S,14S,15R,16S,19S,22S,23R,25S)-2,19-dihydroxy-13,16,23-trimethyl-6,10,17,26,27,30-hexaoxanonacyclo[23.2.2.15,14.15,15.01,23.04,22.08,13.011,16.015,19]hentriacont-28-ene-9,18,24,31-tetrone | present | NPASS | |
| (1R,2S,4S,5'R,6R,7S,8R,9S,10R,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-10,16-diol | present | NPASS | |
| (1R,4R)-1-(beta-D-Glucopyranosyloxy)-4-hydroxy-2-cyclopentene-1-carbonitrile | present | LOTUS | |
| (1S)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycyclopent-2-ene-1-carbonitrile | present | LOTUS | |
| (1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(2R)-4-[(1R,2S,4S,6R,7S,8R,9S,12S,13S,16S,18S)-16-[(2R,3R,4R,5R,6R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-methoxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-2-[(1R,2S,4S,5'R,6R,7S,8R,9S,10R,12S,13R,16S)-10-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (6'S)-beta,epsilon-carotene | present | NPASS |
05DNA & barcoding13 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Turnera ulmifolia has left across the world's sequence archives.
At a glance
DNA specimens13
Marker genes5
GenBank sequences10
eDNA detections10
Countries3
The DNA barcodea real sequence read deposited for this species
GGCAGAACGACCCGCGAACAAGTTGCGAAACACGATCAGGACGCCGGGTGCGAAGCGGCATGGCTGCCATGTCGCCCCCGTTCCCCGGAT …
Turnera ulmifolia isolate leaves internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Turnera ulmifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 30 n = 15
Ploidypolyploid inferred
Chromosome records10–302n range30median30mode28records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3020×CCDB · croinout · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +4
CCDB · croinout — Ghosh, R. B. 1960
CCDB · croinout — Hamel, J. L. 1965
CCDB · croinout — Solis Neffa, V. G. & Fernandez, A. 1993
CCDB · croinout — Tarar, J. L. 1977
CCDB · croinout — Shore, J. S. & Barrett, S. C. H. 1985
CCDB · book-ipcn65 — Hamel 1965
CCDB · ipcn-api-dl — Solis Neffa, V. G. & A. Fernandez. 1993. Estudios cromosómicos en especies de Turnera (Turneraceae). Bonplandia (Corrientes) 7: 101–118.
CCDB · ipcn-api-dl — Fernandez. 2004. Genomic relationships between Turnera krapovickasii (2x, 4x) and T. ulmifolia (6x) (Turneraceae, Turnera). Caryologia 57(1): 45–51.
CCDB · ipcn-api-dl — Shore, J. S. & S. C. H. Barrett. 1985. Morphological differentiation and crossability among populations of the Turnera ulmifolia L. complex (Turneraceae). Syst. Bot. 10: 308–321.
CCDB · book-ipcn75-78 — Tarar 1977
CCDB · book-indian_vol1 — Ghosh, R.B. 1960 ; Hamel, J.L. 1965 ; Sheriff, A. et al. 1967
CCDB · book-indian_vol1 — Tarar, J.L. 1977, 1980
CCDB · book-fedorov — Ghosh R. B. 1960
CCDB · book-fedorov — Hamel 1965
CCDB · kew — Lopez A, Panseri AF, Poggio L, Fernandez A. 2011. Nuclear DNA content in the polyploid complex Turnera ulmifolia (Turnera L., Passifloraceae). Plant Systematics and Evolution 296: 225-230.
2n 104×GoaT · Tree of Sex Database · CCDB · croinout · CCDB · ipcn-api-dl +1
GoaT · Tree of Sex Database — ↗
CCDB · croinout — Shore, J. S. & Barrett, S. C. H. 1984
CCDB · ipcn-api-dl — Shore, J. S. & S. C. H. Barrett. 1984. The effect of pollination intensity and incompatible pollen on seed set in Turnera ulmifolia (Turneraceae). Canad. J. Bot. 62: 1298–1303.
TreeOfSex · plant — Goldblatt1979 ↗
2n 204×CCDB · croinout · CCDB · book-ipcn65 · CCDB · ipcn-api-dl
CCDB · croinout — Guerra, M. Dos S. 1986
CCDB · book-ipcn65 — Raman & K. 1964b
CCDB · ipcn-api-dl — Guerra, M. d. S. 1986. Citogenetica de Angiospermas coletadas en Pernambuco, I. Revista Brasil. Genét. 9: 21–40.
CCDB · ipcn-api-dl — Fernández, A. 1987. Estudios cromosómicos en Turnera y Piriqueta (Turneraceae). Bonplandia (Corrientes) 6: 1–21.
2n 251×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Fernandez. 2004. Genomic relationships between Turnera krapovickasii (2x, 4x) and T. ulmifolia (6x) (Turneraceae, Turnera). Caryologia 57(1): 45–51.
n 153×CCDB · croinout · CCDB · ipcn-api-dl · TreeOfSex · plant
CCDB · croinout — Tarar, J. L. & Dnyansagar, V. R. 1979
CCDB · ipcn-api-dl — TARAR, J. L. & V. R. Dnyansagar. 1979. Meiotic studies in Turnera ulmifolia Linn. var. angustifolia Wilid. J. Indian Bot. Soc. 58: 167–175.
TreeOfSex · plant — Goldblatt1979 ↗
n 101×CCDB · book-ipcn65
CCDB · book-ipcn65 — Raman & K. 1964b
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 240 records
Wild obs. + sensor5 853
Museum / vouchered1 383
Cultivated / captive1
Other3
Origin
Native7
Introduced16
Range
Area of Occupancy AOO17 668 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 3 661≤1 km 593≤10 km 266>10 km 198
4 718 georeferenced · 1 135 without coordinates
Open the mapobservation + sensor5 853
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy80% within 1 km
≤100 m 384≤1 km 58≤10 km 90>10 km 22
554 georeferenced · 829 without coordinates
Open the institutions mapphysical evidence1 383
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions64 of 139 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 213 |
| Bronx, US | 91 |
| Mexico City, MX | 86 |
| Saint Louis, US | 61 |
| Mexico City, MX | 56 |
| Tampa, US | 43 |
| Miami, US | 36 |
| Austin, US | 32 |
| Ciudad de México, MX | 29 |
| National Biodiversity Institute, Costa Ricalocation not on record | 24 |
| BISHlocation not on record | 18 |
| Kew, GB | 18 |
| University of Stellenboschlocation not on record | 17 |
| Universidad Industrial de Santander (UIS)location not on record | 16 |
| Tuxtla Gutiérrez, MX | 15 |
| Brisbane, AU | 15 |
| Canberra, AU | 14 |
| Universidad de Nariño (UdeNar)location not on record | 14 |
| Tapachula, MX | 13 |
| Honolulu, US | 13 |
| Chapingo, MX | 13 |
| UEMAlocation not on record | 12 |
| Museo Entomologico de Leonlocation not on record | 12 |
| Chaguaramas, TT | 12 |
| UEPAlocation not on record | 11 |
| Riverside, US | 11 |
| Altos de Pipe, VE | 10 |
| UNITINSlocation not on record | 9 |
| Berlin, DE | 9 |
| Kensington, AU | 9 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 8 |
| Austin, US | 8 |
| Tuxtla Gutiérrez, MX | 8 |
| Mérida, MX | 8 |
| Palmerston, AU | 8 |
| Mérida, MX | 8 |
| Baroda, IN | 7 |
| Pondicherry, IN | 7 |
| Smithfield, AU | 7 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 7 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 7 |
| UFPIlocation not on record | 6 |
| Blumenau, BR | 6 |
| St. Augustine, TT | 6 |
| Giardini Botanici Hanburylocation not on record | 6 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 6 |
| Masindi, UG | 5 |
| UnBlocation not on record | 5 |
| EL PASO, US | 5 |
| Universidade Federal do Maranhãolocation not on record | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 5 |
| MeiseBGlocation not on record | 4 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 4 |
| FUNEDlocation not on record | 4 |
| South Kensington, GB | 4 |
| Paris, FR | 4 |
| Universidad Nacional de Colombia (UNAL)location not on record | 4 |
| Salvador, BR | 4 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 4 |
| Universidad de Caldas (UCaldas)location not on record | 4 |
| San Francisco de Campeche, MX | 4 |
| Moscow State Universitylocation not on record | 4 |
| HUENFlocation not on record | 4 |
| Guatemala City, GT | 3 |
| Puerto Ayora, EC | 3 |
| UNESP-ISlocation not on record | 3 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Xiamen, CN | 3 |
| TAIElocation not on record | 3 |
| Chicago, US | 3 |
| LDlocation not on record | 3 |
| UFBAlocation not on record | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 3 |
| Laboratorio de Ictiologialocation not on record | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 3 |
| NHMJlocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Universidade Federal de Sergipe (UFS)location not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Culiacán, MX | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| San Diego, US | 3 |
| CPATSAlocation not on record | 3 |
| Auckland, NZ | 3 |
| UFSClocation not on record | 2 |
| San José, CR | 2 |
| Denver, US | 2 |
| Campo Grande, BR | 2 |
| JBRJlocation not on record | 2 |
| UNICAMPlocation not on record | 2 |
| UNESClocation not on record | 2 |
| Santiago de Cali, CO | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| UFMSlocation not on record | 2 |
| Seychelles National Herbariumlocation not on record | 2 |
| James Cook Townsvillelocation not on record | 2 |
| Montréal, CA | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| Universidade Federal de Goiáslocation not on record | 2 |
| Santa Cruz de la Sierra, BO | 2 |
| MEXUlocation not on record | 2 |
| OTSlocation not on record | 1 |
| Dresden, DE | 1 |
| Nishihara, JP | 1 |
| Cambridge, US | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| Santarém, BR | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Wlocation not on record | 1 |
| HAWlocation not on record | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| GB | 1 |
| Criciúma, BR | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Adelaide, AU | 1 |
| Brasília, BR | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| UFPRlocation not on record | 1 |
| UESBlocation not on record | 1 |
| UFERSAlocation not on record | 1 |
| Cuiabá, BR | 1 |
| CJBGlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| UEMlocation not on record | 1 |
| INMAlocation not on record | 1 |
| Hobart, AU | 1 |
| Mexico City, MX | 1 |
| Gump Stationlocation not on record | 1 |
| Paleontological Collectionlocation not on record | 1 |
| Dublin, IE | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Davis, US | 1 |
139 institutions · 1 261 of 1 383 vouchered records shown · 119 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Turnera ulmifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median26.2 °C 23.4–26.2
Seasonal swing summer↔winter2.50 °C
Max temp (day)29.4 °C
Min temp (night)23.4 °C 17.3–23.4
Precipitation248 mm/mo 74.9–248
Air humidity67.8 % 51.3–67.8
Moisture balance77.2 mm/mo -59.2–77.2
Vapour deficit1,097 Pa 1,097–1,370
Wind speed3.00 m/s 2.70–3.00
Cloud cover30.0 % 20.2–30.0
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.