Turnera chamaedrifolia

Cambess. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Turneraceae/Turnera

At a glance

Occurrence records546

Data sources10

Biological traits8

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Turnera chamaedrifolia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility546 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF546 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 26

01Narrative

Turnera chamaedrifolia is a species of Turnera in Bahia and Mina Gerias, Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyte detailedterrestrial

Growth formShrub/Subshrub

Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo de Altitude, Campo Limpo, Campo Rupestre, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga, Vegetação Sobre Afloramentos R

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Turnera chamaedrifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK257241.1 ↗585 bpBrazil

ACGT

CCGGACCCTGCATGGCAGAACGACCCGCGGACAGGTTGAGACACAAGATCGGGAACCCGGGTGCGGAGCGGCACTTTCCCGTGCAGCCCC …

Turnera chamaedrifolia voucher L. Rocha 376 (HUEFS) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Turnera chamaedrifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidypolyploid inferred

Chromosome records26–262n range26median26mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 264×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Fernández, A. 1987. Estudios cromosómicos en Turnera y Piriqueta (Turneraceae). Bonplandia (Corrientes) 6: 1–21.

CCDB · ipcn-api-dl — Solis Neffa, V. G. & A. Fernandez. 1993. Estudios cromosómicos en especies de Turnera (Turneraceae). Bonplandia (Corrientes) 7: 101–118.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type546 records

Wild obs. + sensor19

Museum / vouchered527

Origin

Native306

Range

Area of Occupancy AOO1 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 11≤1 km 2≤10 km 1

14 georeferenced · 5 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 524 without coordinates

Open the institutions mapphysical evidence527

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorio de Ictiologialocation not on record	113
Salvador, BR	57
Feira de Santana, BR	56
UFBAlocation not on record	30
Bronx, US	28
Masindi, UG	28
Universidade Federal de Sergipe (UFS)location not on record	26
CEPLAClocation not on record	26
UFPElocation not on record	23
Chaguaramas, TT	15
JBRJlocation not on record	12
USP-IBlocation not on record	12
Departamento de Sistematica e Ecologialocation not on record	11
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	10
UNIVASFlocation not on record	10
Universidade Federal do Rio Grande do Nortelocation not on record	9
UnBlocation not on record	6
Chicago, US	6
Cruz das Almas, BR	5
UFRPElocation not on record	4
UFSClocation not on record	4
Saint Louis, US	3
University of Stellenboschlocation not on record	3
Brasília, BR	3
Kew, GB	3
Cenargenlocation not on record	3
Bogotá, D.C., CO	2
ASUlocation not on record	2
HACAMlocation not on record	2
Brasília, BR	2
Universidade Federal de Santa Catarinalocation not on record	1
UNICAMPlocation not on record	1
Universidade de São Paulolocation not on record	1
UFMGlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
UFPRlocation not on record	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
CPATSAlocation not on record	1
Porto Alegre, BR	1
IPA/SPlocation not on record	1
Universidade Federal do Maranhãolocation not on record	1
INMAlocation not on record	1
URCAlocation not on record	1

43 institutions · 527 of 527 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Turnera chamaedrifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)