Turbinicarpus schmiedickeanus

(Boed.) Buxb. & Backeb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Turbinicarpus

At a glance

Occurrence records30

Data sources10

Biological traits8

DNA specimens6

eDNA detections7

Sources10 archives

Databases and archives Turbinicarpus schmiedickeanus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Turbinicarpus schmiedickeanus is a species of plant in the family Cactaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.032 mg

⚠ sources differ — TRY: 0.032 mg · GIFT: 0.051 mg

Seed mass max0.071 mg

Seed mass min0.028 mg

Life cycle & reproduction1

Life formsucculent subshrub

Habitat & environment3

Climatedesert or dry shrubland

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition9 compounds

Compounds documented for Turbinicarpus schmiedickeanus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phenylethylamines5

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1

Aporphine alkaloids $ Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1

Amarylidaceae alkaloids $ Phenylethylamines1

Isoquinoline alkaloids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pellotine	present	LOTUS
1,2,3,4-Tetrahydro-6,7,8-trimethoxyisoquinoline	present	LOTUS
2-Phenylethylamine	present	LOTUS
6,7-Dimethoxy-1-methyl-1,2,3,4-tetrahydroisoquinolin-8-ol	present	LOTUS
Hordenine	present	LOTUS
Mescaline	present	LOTUS
N-Methylmescaline	present	LOTUS
N-Methyltyramine	present	LOTUS
Tyramine	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Turbinicarpus schmiedickeanus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMK449137.1 ↗539 bp

ACGT

GGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATCAACCCCAGGATACCGATATCTTGGCAGCATTCCGAGTAACTCCTCAA …

Turbinicarpus schmiedickeanus subsp. gracilis ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6

plant barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor24

Museum / vouchered4

Cultivated / captive1

Other1

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy4% within 1 km

≤1 km 1>10 km 23

24 georeferenced

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Giardini Botanici Hanburylocation not on record	1

1 institutions · 1 of 4 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Turbinicarpus schmiedickeanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 2.90–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C 7.20–22.0

Min temp (night)9.00 °C -2.40–9.00

Precipitation34.7 mm/mo 34.7–133

Air humidity50.9 % 50.9–57.4

Moisture balance-93.3 mm/mo -93.3–54.9

Vapour deficit884 Pa 419–884

Wind speed4.10 m/s 4.10–6.00

Cloud cover25.5 % 25.5–40.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)