Turbinicarpus pseudopectinatus

(Backeb.) Glass & R.A.Foster · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Turbinicarpus

At a glance

Occurrence records68

Data sources10

Biological traits8

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Turbinicarpus pseudopectinatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS11 compounds

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Turbinicarpus pseudopectinatus is a species of plant in the family Cactaceae. It is endemic to Coahuila, Nuevo León, San Luis Potosí, and Tamaulipas states in northeastern Mexico. Its natural habitats are temperate forests and hot deserts.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.074 mg

Seed mass max0.074 mg

Seed mass min0.074 mg

Life cycle & reproduction1

Life formsucculent subshrub

Habitat & environment3

Climatedesert or dry shrubland

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition11 compounds

Compounds documented for Turbinicarpus pseudopectinatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phenylethylamines5

Aporphine alkaloids $ Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids2

Phenylalanine-derived alkaloids1

Isoquinoline alkaloids1

Amarylidaceae alkaloids $ Phenylethylamines1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pellotine	present	LOTUS
(-)-Pellotine	present	LOTUS
(1S)-6,7-dimethoxy-1-methyl-1,2,3,4-tetrahydroisoquinolin-8-ol	present	LOTUS
1,2,3,4-Tetrahydro-6,7,8-trimethoxyisoquinoline	present	LOTUS
1-Phenethylamine	present	LOTUS
2-Phenylethylamine	present	LOTUS
Hordenine	present	LOTUS
Mescaline	present	LOTUS
N-Methylmescaline	present	LOTUS
N-Methyltyramine	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Turbinicarpus pseudopectinatus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMK449131.1 ↗539 bp

ACGT

GGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATATCAACCCCAGGATACCGATATCTTGGCAGCATTCCGAGTAACTCCTCAA …

Turbinicarpus pseudopectinatus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1

plant barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor65

Museum / vouchered3

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 65

65 georeferenced

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	1
ASUlocation not on record	1

2 institutions · 2 of 3 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Turbinicarpus pseudopectinatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)