Tulipa turkestanica

(Regel) Regel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Tulipa

At a glance

Occurrence records232

Data sources14

Biological traits17

DNA specimens6

eDNA detections6

Sources14 archives

Databases and archives Tulipa turkestanica's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility232 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF232 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT42.9 Gbp

01Narrative

Tulipa turkestanica, the Turkestan tulip, is a species of tulip native to central Asia (Kyrgyzstan, Tajikistan, Uzbekistan, and Xinjiang).Merkodovich, N.A. (ed.) (1941). Flora Uzbekistana 1: 1-566. Izd-va Akademii nauk Uzbekskoi SSR, Tashkent.Nikitina, E.V. & al (eds.) (1951). Flora Kirgizskoi SSR 3: 1-148. Frunze : Izd-vo KirgizFAN SSSR.Ovczinnikov, P.N. (ed.) (1963). Flora Tadzhikskoi SSR 2: 1-454. Izd-vo Akademii nauk SSSR, Moskva.Czerepanov, S.K. (1995). Vascular Plants of Russia and Adjacent States (The Former USSR): 1-516. Cambridge University Press. It was first described by Eduard August von Regel in 1873 as a variety of T. sylvestris, then elevated to full species status two years later.Richard Wilford, Tulips, Species and hybrids for the gardener (Portland, Timber Press 2006), 162Regel, Eduard August von 1875. Trudy Imperatorskago S.-Peterburgskago Botaniceskago Sada. Acta Horti Petropolitani 3(2):296

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max0.03 m

Plant height min0.01 m

Seed mass3.19 mg

Life cycle & reproduction5

Flowering endApr

Flowering startMar

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max2 500 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains, stony places

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition18 compounds

Compounds documented for Tulipa turkestanica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Fatty acyl glycosides of mono- and disaccharides4

Monosaccharides3

Amarylidaceae alkaloids2

Disaccharides1

Amarylidaceae alkaloids $ Indolizidine alkaloids1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pancratistatin	present	NPASS
(2R,3S,4R,5R)-2,3,4,5,6-pentahydroxyhexanal	present	LOTUS
5,7-Dioxa-12-azapentacyclo[10.6.1.02,10.04,8.015,19]nonadeca-1(18),2,4(8),9,15(19),16-hexaen-17-ol	present	NPASS
6-O-[(3S)-3,4-Dihydroxy-2-methylidenebutanoyl]-D-glucose	present	LOTUS
6-Tuliposide A	present	LOTUS
6-Tuliposide B	present	LOTUS
[(2R,3S,4S,5R,6R)-3,4,5,6-tetrahydroxyoxan-2-yl]methyl (3S)-3,4-dihydroxy-2-methylidenebutanoate	present	LOTUS
[(2R,3S,4S,5R,6S)-3,4,5,6-tetrahydroxyoxan-2-yl]methyl (3S)-3,4-dihydroxy-2-methylidenebutanoate	present	LOTUS
[(2R,3S,4S,5R,6S)-3,4,5,6-tetrahydroxyoxan-2-yl]methyl 4-hydroxy-2-methylidenebutanoate	present	LOTUS
[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(4-hydroxy-2-methylidenebutanoyl)oxyoxan-2-yl]methyl (3S)-3,4-dihydroxy-2-methylidenebutanoate	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulipa turkestanica has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV765342.1 ↗297 bpUzbekistan · 2025

ACGT

CTGCGGAAGGATCATTGTCGATGCCCGATCGTAAGACCGCGAACTTGTTAACGGATGTCACCAGGGGTGTCGGGCTAGCTCTGCTCCCTG …

Tulipa turkestanica voucher Bobur Zirabulak 1 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Tulipa turkestanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size42 934 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Tulipa turkestanica42.93 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidy2× / 4× cytotypes

Chromosome records48–482n range48median48mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 486×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1981. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Eriostemones (Liliaceae). Pl. Syst. Evol. 139: 47–55.

CCDB · book-ipcn67-71 — SOUTHERN, D. I. 1967. Species relationships in the genus Tulipa. Chromosoma 23: 80-94.

CCDB · book-atlas-flowering-plants

CCDB · kew — Southern DI. 1967. Species relationships in genus Tulipa. Chromosoma 23: 80-94.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type232 records

Wild obs. + sensor196

Museum / vouchered33

Cultivated / captive3

Origin

Native1

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 111≤1 km 60≤10 km 7>10 km 2

180 georeferenced · 16 without coordinates

Open the mapobservation + sensor196

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 4≤1 km 4≤10 km 7>10 km 2

17 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence33

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	12
SLU Artdatabankenlocation not on record	4
LDlocation not on record	3
Uniwersytet Opolskilocation not on record	2
Saint Louis, US	1
Wlocation not on record	1
Helsinki, FI	1
Oskarshamn, SE	1
Mlocation not on record	1
Dekalb, US	1

10 institutions · 27 of 33 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Tulipa turkestanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)