Tulipa sylvestris
speciesAt a glance
Occurrence records32 746
Data sources13
Biological traits38
DNA specimens39
eDNA detections34
Sources13 archives
Databases and archives Tulipa sylvestris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility32 746 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics39 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Chemical compositionLOTUS · NPASS57 compounds
Occurrence & distributionGBIF32 746 records
Environmental DNA2 datasets · 6 countries34 detections
DNA & barcodingBOLD · NCBI39 specimens
Genome at a glanceCCDB · GoaT54.1 Gbp
01Narrative
La Tulipe des bois ou Tulipe sauvage est une espèce géophyte qui appartient à la famille des Liliacées. C'est une des quelque dix tulipes indigènes en Europe.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology11
Leaf size3 162 mm²
Leaf width max20 mm
Leaf width min10 mm
Plant height0.3 m
⚠ sources differ — GIFT: 0.3 m · LEDA: 0.3 m · TRY: 0.43 m
Plant height generative0.325 m
Plant height max0.5 m
Plant height min0.1 m
Seed length6.05 mm
Seed mass7.05 mg
⚠ sources differ — TRY: 7.05 mg · LEDA: 8.82 mg · GIFT: 6.37 mg
Seed mass max7.43 mg
Seed mass min2.85 mg
Life cycle & reproduction12
Deciduousnessvernal
⚠ sources differ — TRY: vernal · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: anemochorous
Flowering endMay
Flowering startApr
Life formbulbous geophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climberself-supporting
Elevation max2 000 m
Elevation mean1 700 m
Elevation min1 400 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTforest
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC3
Other traits2
Diaspore typeseed
Plant support typefree-standing
03Chemical composition57 compounds
Compounds documented for Tulipa sylvestris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones7
Labdane diterpenoids6
Norlabdane diterpenoids6
Oleanane triterpenoids5
Ursane and Taraxastane triterpenoids4
Documented compounds57 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | NPASS | |
| (+-)-Tulipaline B (compound 6) | present | LOTUS | |
| (1R,4aS,5R,6R,8aR)-5-[(3S,4S,5E)-3,4-dihydroxy-3-methyl-5-(3-methyl-5-oxofuran-2-ylidene)pentyl]-6-hydroxy-1,4a,6-trimethyl-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (1R,4aS,5R,6R,8aR)-6-acetyloxy-5-(2-carboxyethyl)-1,4a,6-trimethyl-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | NPASS | |
| (2S,3R,4S,5S,6R)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (3,4-Dihydroxyphenyl) 3-(3,4-dihydroxyphenyl)prop-2-enoate | present | NPASS | |
| (3S)-5-[(1S,4aS,8aS)-2,5,5,8a-tetramethyl-1,4,4a,6,7,8-hexahydronaphthalen-1-yl]-3-methylpent-1-en-3-ol | present | NPASS | |
| (3S,4aR,6aR,7R,10aS,10bR)-3,4a,7,10a-tetramethyl-2,5,6,6a,8,9,10,10b-octahydro-1H-benzo[f]chromene-3,7-dicarboxylic acid | present | NPASS | |
| (3S,4aR,6aR,7R,10aS,10bR)-3-(carboxymethyl)-3,4a,7,10a-tetramethyl-2,5,6,6a,8,9,10,10b-octahydro-1H-benzo[f]chromene-7-carboxylic acid | present | NPASS | |
| (3S,4aR,6aR,7R,10aS,10bR)-3-ethenyl-3,4a,7,10a-tetramethyl-2,5,6,6a,8,9,10,10b-octahydro-1H-benzo[f]chromene-7-carboxylic acid | present | NPASS |
05DNA & barcoding39 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulipa sylvestris has left across the world's sequence archives.
At a glance
DNA specimens39
Marker genes6
GenBank sequences10
eDNA detections34
Countries6
The DNA barcodea real sequence read deposited for this species
ACGGGGGTGGTACGGGATAACGAAACCCCGGCGCTGTATGCGCCAAGGAACATATATGACCGGATGGACGTGCGCCTTTGCCCTTGTGGT …
Tulipa sylvestris subsp. australis voucher KS23 HER0470 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL5★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Tulipa sylvestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size54 142 080 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Tulipa sylvestris54.14 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records24–482n range24median24mode41records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2424×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iber-fl +6
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — Cesca G., Martino P., Peruzzi L. - 2012. Numeri Cromosomici per la Flora Italiana: 1486. Inform. Bot. Ital. , 44(1): 174.
CCDB · ita-fl — GARBARI F., TORNADORE N. - 1970. Numeri cromosomici per la flora italiana:1-2.. Inform. Bot. Ital. , 2(2): 74-75.
CCDB · ita-fl — SCRUGLI A., BOCCHIERI E., DE MARTIS B. - 1980. Tulipa australis Link (Liliaceae) nuova per la flora di Sardegna.. Atti Soc. Tosc. Sci. Nat. Pisa. Mem., ser. B , 87: 131-134.
CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).
CCDB · iber-fl — Contribution la connaissance cytotaxonomique des spermatophyta du Portugal. VIII. Liliaceae Barros Neves, J.Bol. Soc. Brot. ser. 247: 157-212(1973).
CCDB · iber-fl — Sur la caryologie de quelques plantes rcoltes pendant la III Reunion de Botanique Pninsulaire. Fernandes, A. & M. Queirs.Mem. Soc. Brot.21: 343-385(1971).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 169-175. Pajarn Sotomayor, S.Anales Jard. Bot. Madrid38(2): 519-522(1982).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 630-642. Daz Lifante, Z.Lagascalia16(2): 328-333(1990).
CCDB · fl-europaea — Barros Neves,
CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1982. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Leiostemones (Liliaceae). Pl. Syst. Evol. 139: 163–178.
CCDB · ipcn-api-dl — Caixinhas, L., T. Vasconcelos, J. Monjardino, A. D. Barão, C. P. Ricardo & J. N. Martins. 1991. Situation actuelle de la banque de germplasme des espèces endémiques du Portugal. Bot. Chron. (Patras) 10: 603–608.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Raamsdonk, L. W. D. v. & T. d. Vries. 1992. Biosystematic studies in Tulipa sect. Eriostemones (Liliaceae). Pl. Syst. Evol. 179: 26–41.
CCDB · ipcn-api-dl — Marcucci, R. & N. Tornadore. 1999. Mediterranean chromosome number reports 9 (1089--1098). Fl. Medit. 9: 372–378.
CCDB · ipcn-api-dl — Natarajan, G. 1979. Etude caryosystematique de quelques monocotyledones de la garrigue Languedocienne. Nat. Monspel., Sér. Bot. 30: 1–27.
CCDB · ipcn-api-dl — Natarajan, G. 1979a. In IOPB chromosoJne number reports LXV. Taxon 28: 629.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1973. Cytotaxonomy of Spanish plants. Monocotyledons. Lagascalia 3: 14 7-182. I
CCDB · book-ipcn73-74 — SUSNIK, F., & M. LOVKA. 1973. In IOPB chromosome number reports XLI. Taxon 22: 459-464.
CCDB · book-atlas-flowering-plants — Upcott & L. C. '36
CCDB · kew — Southern DI. 1967. Species relationships in genus Tulipa. Chromosoma 23: 80-94.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
CCDB · CromoCat 2015 — Pajarón Sotomayor, S. (1982). Números cromosomáticos de plantas occidentales, 169-175. Anales Jard. Bot. Madrid 38(2): 519-522.
2n 4814×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · ita-fl — CESCA G. - 1986 (1984). Note fitogeografiche e citotassonomiche su Adoxa moschatellina L., Tulipa sylvestris L., Fritillaria tenella Bieb. Biogeographia , 10: 109-141.
CCDB · ita-fl — Colombo P., Marcen C. - 1989 (1989). Numeros cromosomaticos de plantas occidentales, 539 - 550.. Anales Jardin Botanico de Madrid , 47(1): 168-174.
CCDB · ita-fl — Colombo P. & Marcen C. - 1990. Nmeros cromosomticos de plantas occidentales, 539-550. Anales Jard. Bot. Madrid , 47(1): 167-174.
CCDB · ipcn-api-dl — Colombo, P. & C. Marceno. 1990. Números cromosomáticos de plantas occidentales, 539--550. Anales Jard. Bot. Madrid 47: 167–174.
CCDB · ipcn-api-dl — Raamsdonk, L. W. D. v. & T. d. Vries. 1992. Biosystematic studies in Tulipa sect. Eriostemones (Liliaceae). Pl. Syst. Evol. 179: 26–41.
CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1981. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Eriostemones (Liliaceae). Pl. Syst. Evol. 139: 47–55.
CCDB · ipcn-api-dl — Papanicolaou, K. & S. Kokkini. 1983. Inheritance of dissected outer perianth-segments in Tulipa sylvestris L. subsp. australis (Link) Pamp. (Liliaceae). Feddes Repert. 94: 635–637.
CCDB · book-ipcn67-71 — SOUTHERN, D. I. 1967. Species relationships in the genus Tulipa. Chromosoma 23: 80-94.
CCDB · book-atlas-flowering-plants — Upcott & L. C. '36
CCDB · CromoCat 2015 — Colombo, P. & Marcenó, C. (1990). Números cromosomáticos de plantas occidentales, 539-550. Anales Jard. Bot. Madrid 47: 167-174.
CCDB · CromoCat 2015 — Raamsdonk, L. W. D. van & T. de Vries (1992). Biosystematic studies in Tulipa sect. Eriostemones (Liliaceae) Pl. Syst. Evol. 179: 26-41
CCDB · CromoCat 2015 — Sokolowska-kulczycka, A. (1980). Embryological studies of Tofieldia calyculata (L.) Wahlb. Acta Biologica Cracoviensia, Series Botanica 22: 113-128.
2n 363×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Athanasiou, K. 1988. Some cytogeographical notes on the genus Tulipa L. (Liliaceae). Bot. Chron. (Patras) 8: 51–59.
CCDB · eflora
CCDB · CromoCat 2015 — Basak, N. & N. Özhatay (1997). Cytotaxonomic notes on the Tulipa species (Liliaceae) of European Turkey Bocconea 5:727-721
n 124×CCDB · iber-fl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74
CCDB · iber-fl — Estudios cariolgicos en especies espaolas del orden Liliales. III. Liliaceae. Ruz Rejn, M.Anales Inst. Bot. Cavanilles34(2): 733-759(1978).
CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Fernndez Morales, M. J.Taxon23(5/6): 805(1974).
CCDB · book-ipcn75-78 — Ruiz Rejon 1978
CCDB · book-ipcn73-74 — RUIZ REJON, M. In IOPB chromosome number reports XLVI. Taxon 23: 801- 812.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type32 746 records
Wild obs. + sensor31 080
Museum / vouchered1 475
Cultivated / captive15
Other176
Origin
Native6
Introduced371
Range
Area of Occupancy AOO47 564 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 11 717≤1 km 1 730≤10 km 11 685>10 km 362
25 494 georeferenced · 5 586 without coordinates
Open the mapobservation + sensor31 080
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy73% within 1 km
≤100 m 361≤1 km 176≤10 km 172>10 km 31
740 georeferenced · 735 without coordinates
Open the institutions mapphysical evidence1 475
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 7>10 km 6
13 georeferenced · 2 without coordinates
Open the mapnot free-living15
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions38 of 85 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| KMNlocation not on record | 237 |
| BIO-UNIPIlocation not on record | 126 |
| Olocation not on record | 106 |
| LDlocation not on record | 89 |
| BFLlocation not on record | 86 |
| Uppsala, SE | 54 |
| MeiseBGlocation not on record | 51 |
| SLU Artdatabankenlocation not on record | 44 |
| Oskarshamn, SE | 43 |
| DBF-NHMDlocation not on record | 29 |
| Zürich, CH | 27 |
| Tartu, EE | 22 |
| South Kensington, GB | 21 |
| Bergen, NO | 21 |
| Wlocation not on record | 20 |
| Brussel, BE | 17 |
| UGentlocation not on record | 15 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 14 |
| MAlocation not on record | 14 |
| Görlitz, DE | 14 |
| Philadelphia, US | 12 |
| València, ES | 11 |
| Provincia di Livornolocation not on record | 11 |
| Barcelona, ES | 9 |
| Dresden, DE | 9 |
| Zürich, CH | 8 |
| Tallinn, EE | 7 |
| Bourges, FR | 7 |
| Millersville, US | 7 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 7 |
| Trondheim, NO | 6 |
| BClocation not on record | 6 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 6 |
| Auckland, NZ | 5 |
| CICYTEXlocation not on record | 5 |
| College Park, US | 4 |
| Berlin, DE | 4 |
| BDBClocation not on record | 4 |
| GJOlocation not on record | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| OLAlocation not on record | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| PRClocation not on record | 3 |
| Philadelphia, US | 3 |
| Porrentruy, CH | 3 |
| Moscow State Universitylocation not on record | 3 |
| Corvallis, US | 2 |
| Philadelphia, US | 2 |
| Uniwersytet Wrocławskilocation not on record | 2 |
| Universität Erlangen-Nürnberglocation not on record | 2 |
| Bern, CH | 2 |
| TROMlocation not on record | 2 |
| Fulda, DE | 2 |
| SNSNMClocation not on record | 1 |
| CJBGlocation not on record | 1 |
| ER Hellerlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| FLADlocation not on record | 1 |
| Nijmegen, NL | 1 |
| Boumlocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| NMWlocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Alicante, ES | 1 |
| Frankfurt am Main | 1 |
| Coimbra, PT | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| nbflocation not on record | 1 |
| BRNUlocation not on record | 1 |
| Xiamen, CN | 1 |
| Santa Barbara, US | 1 |
| Bronx, US | 1 |
| Badajoz, ES | 1 |
| Columbia, US | 1 |
| Emporia, US | 1 |
| Salzburg, AT | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
85 institutions · 1 250 of 1 475 vouchered records shown · 222 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA34 detections
Where the DNA of Tulipa sylvestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found34
Studies independent surveys2
Countries6
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 34 detections have coordinates
Open the map6 countries0
cultivated from wild source
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.10 °C 3.70–14.4
Seasonal swing summer↔winter16.4 °C
Max temp (day)12.8 °C 5.90–19.9
Min temp (night)3.20 °C 1.60–8.70
Precipitation47.0 mm/mo 22.6–93.1
Air humidity61.0 % 46.3–66.1
Moisture balance-23.0 mm/mo -91.5–41.5
Vapour deficit451 Pa 273–1,044
Wind speed3.20 m/s 2.60–4.60
Cloud cover43.5 % 30.7–56.5
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.