Tulipa orphanidea

Boiss. ex Heldr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Tulipa

At a glance

Occurrence records89

Data sources11

Biological traits9

DNA specimens14

eDNA detections13

Sources11 archives

Databases and archives Tulipa orphanidea's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF89 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceCCDB · GoaT36.3 Gbp

01Narrative

Tulipa orphanidea is a species of flowering plant in the Liliaceae family. It was described by Pierre Edmond Boissier and Theodor Heinrich Hermann von Heldreich (1862).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formbulbous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulipa orphanidea has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes4

GenBank sequences10

eDNA detections13

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH555214.1 ↗698 bp

ACGT

GTGAACCTGCGGAAGGATCATTGTCGATGCCCGATCGAAAGACTGTGAACTTGTAAACGGATGCCACCAGGGGTGTCGGGCTAGCTCCGC …

Tulipa orphanidea voucher RNG:6322ia_4 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Tulipa orphanidea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size36 259 350 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Tulipa orphanidea36.26 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× / 3× / 4× cytotypes

Chromosome records24–482n range24median24mode19records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2410×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Yoshida, M. 1980. Karyotype analysis in Tulipa XIV. Tottori-daigaku Iry;amogijutsu Tankidaigakubu Kenky;amu H;amokoku. 4: 23–34. (In Japanese).

CCDB · ipcn-api-dl — Couzin, D. A. & D. P. Fox. 1973. U-type exchange in Tulip meiosis. Chromosoma 41: 421 –436.

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1981. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Eriostemones (Liliaceae). Pl. Syst. Evol. 139: 47–55.

CCDB · ipcn-api-dl — Tzanoudakis, D., G. Iatrou, Z. Kypriotakis & D. Christodoulakis. 1991. Cytogeographical studies in some Aegean Liliaceae. Bot. Chron. (Patras) 10: 761–775.

CCDB · book-ipcn67-71 — SOUTHERN, D. I. 1967. Species relationships in the genus Tulipa. Chromosoma 23: 80-94.

CCDB · book-ipcn73-74 — HOLITSCHER, Q. 1972. Pruhonicky sortiment tulipanu. Acta Pruhori. 27: 17-48.

CCDB · kew — Southern DI. 1967. Species relationships in genus Tulipa. Chromosoma 23: 80-94.

2n 487×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1981. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Eriostemones (Liliaceae). Pl. Syst. Evol. 139: 47–55.

CCDB · ipcn-api-dl — Basak, N. & N. Özhatay. 1997. Cytotaxonomic notes on the Tulipa species (Liliaceae) of European Turkey. Bocconea 5: 727–731.

CCDB · book-ipcn67-71 — SOUTHERN, D. I. 1967. Species relationships in the genus Tulipa. Chromosoma 23: 80-94.

CCDB · book-atlas-flowering-plants

CCDB · kew — Southern DI. 1967. Species relationships in genus Tulipa. Chromosoma 23: 80-94.

2n 362×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Tzanoudakis, D., G. Iatrou, Z. Kypriotakis & D. Christodoulakis. 1991. Cytogeographical studies in some Aegean Liliaceae. Bot. Chron. (Patras) 10: 761–775.

CCDB · ipcn-api-dl — Basak, N. & N. Özhatay. 1997. Cytotaxonomic notes on the Tulipa species (Liliaceae) of European Turkey. Bocconea 5: 727–731.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type89 records

Wild obs. + sensor63

Museum / vouchered22

Cultivated / captive4

Origin

Native1

Introduced1

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 31≤1 km 14≤10 km 2>10 km 9

56 georeferenced · 7 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence22

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 3 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	8
LDlocation not on record	7
Görlitz, DE	1
Wlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
South Kensington, GB	1
School of Biology, Aristotle University of Thessalonikilocation not on record	1

7 institutions · 20 of 22 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA13 detections

Where the DNA of Tulipa orphanidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–10.4

Seasonal swing summer↔winter24.2 °C

Max temp (day)15.7 °C

Min temp (night)3.20 °C

Precipitation42.3 mm/mo

Air humidity54.3 %

Moisture balance-49.4 mm/mo

Vapour deficit708 Pa

Wind speed2.70 m/s

Cloud cover34.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)