Tulipa linifolia

Regel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Tulipa

At a glance

Occurrence records19

Data sources12

Biological traits16

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Tulipa linifolia's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF19 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT14.8 Gbp

01Narrative

Tulipa linifolia, the flax-leaved tulip or Bokhara tulip,Cornell University: Tulip, Bkhara is a species of flowering plant in the tulip genus Tulipa (Clusiana group), family Liliaceae, native to Tajikistan, Uzbekistan, northern Iran and Afghanistan.Kew World Checklist of Selected Plant Families Growing to 20 cm tall, it is a bulbous perennial with wavy red-margined sword-shaped leaves, and bowl-shaped red flowers in early to mid-spring. Each petal has blackish marks at the base.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.3 m

Plant height min0.1 m

Life cycle & reproduction5

Flowering endApr

Flowering startApr

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max2 400 m

Elevation min500 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTMottled outcrops (always ?).

Woodinessnon-woody

03Chemical composition7 compounds

Compounds documented for Tulipa linifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Fatty acyl glycosides of mono- and disaccharides3

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
6-Tuliposide A	present	LOTUS
6-Tuliposide B	present	LOTUS
[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(4-hydroxy-2-methylidenebutanoyl)oxyoxan-2-yl]methyl (3S)-3,4-dihydroxy-2-methylidenebutanoate	present	LOTUS
alpha-Methylene butyrolactone	present	LOTUS
Tulipalin B	present	LOTUS
Tuliposide A	present	LOTUS
Tuliposide D	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulipa linifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences9

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHF952967.1 ↗743 bp

ACGT

ATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATTACCTGACCGAAAGACCGCGA …

Tulipa linifolia genomic DNA containing 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2, 28S rRNA gene, specimen voucher K:Chase 12001

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Tulipa linifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size14 804 475 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Tulipa linifolia14.8 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode13records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2413×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1982. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Leiostemones (Liliaceae). Pl. Syst. Evol. 139: 163–178.

CCDB · ipcn-api-dl — Yoshida, M. 1980. Karyotype analysis in Tulipa XIV. Tottori-daigaku Iry;amogijutsu Tankidaigakubu Kenky;amu H;amokoku. 4: 23–34. (In Japanese).

CCDB · ipcn-api-dl — Zakharjeva, O. I. 1990. <In> A. Takhtajan (editor), Numeri Chromosomatum Magnoliophytorum Florae URSS, Aceraceae--Menyanthaceae. Nauka, Leninopoli

CCDB · book-ipcn75-78 — Bochantseva 1972

CCDB · book-ipcn73-74 — HOLITSCHER, Q. 1972. Pruhonicky sortiment tulipanu. Acta Pruhori. 27: 17-48.

CCDB · kew — Leitch IJ, Beaulieu JM, Cheung K, Hanson L, Lysak M, Fay MF. 2007. Punctuated genome size evolution in Liliaceae. Journal of Evolutionary Biology 20: 2296-2308.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type19 records

Wild obs. + sensor4

Museum / vouchered10

Cultivated / captive5

Origin

Introduced1

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 3

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence10

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 4 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Opolskilocation not on record	3
Kew, GB	2
Edinburgh, GB	2
Bronx, US	1
Moscow State Universitylocation not on record	1
Tilburg, NL	1

6 institutions · 10 of 10 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Tulipa linifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)