Tulipa ingens

Hoog · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Tulipa

At a glance

Occurrence records98

Data sources9

Biological traits16

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Tulipa ingens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility98 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF98 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB26.2 Gbp

01Narrative

Tulipa tubergeniana là một loài thực vật có hoa trong họ Liliaceae. Loài này được Hoog miêu tả khoa học đầu tiên năm 1904.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.35 m

Plant height min0.15 m

Life cycle & reproduction5

Flowering endApr

Flowering startApr

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max2 500 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulipa ingens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR380922.1 ↗5 851 bpUzbekistan

ACGT

ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACCAATTCATACGGTGAAACTGC …

Tulipa ingens isolate Uzb10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tulipa ingens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size26 161 500 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Tulipa ingens26.16 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 245×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1982. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Leiostemones (Liliaceae). Pl. Syst. Evol. 139: 163–178.

CCDB · book-ipcn75-78 — Bochantseva 1972

CCDB · book-ipcn73-74 — HOLITSCHER, Q. 1972. Pruhonicky sortiment tulipanu. Acta Pruhori. 27: 17-48.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type98 records

Wild obs. + sensor8

Museum / vouchered89

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1≤1 km 4>10 km 1

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 1

6 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence89

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Academy of Sciences of the Republic of Uzbekistanlocation not on record	80
Moscow State Universitylocation not on record	7
BRNUlocation not on record	1
Uniwersytet Opolskilocation not on record	1

4 institutions · 89 of 89 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)