Tulipa humilis

Herb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Tulipa

At a glance

Occurrence records82

Data sources12

Biological traits15

DNA specimens29

eDNA detections42

Sources12 archives

Databases and archives Tulipa humilis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility82 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF82 records

Environmental DNA1 datasets · 1 countries42 detections

DNA & barcodingBOLD · NCBI29 specimens

Genome at a glanceCCDB · GoaT29.8 Gbp

01Narrative

Tulipa humilis is a species of flowering plant in the lily family, found in Syria, Lebanon, Israel, Turkey, Iran, and the North Caucasus region of Russia. The flowers are pink with yellow centers. Its preferred habitat are rocky mountain slopes.Pacific Bulb SocietyHerbert, William 1844. Edwards's Botanical Register 30: 30–31 description in Latin, commentary in English. It is known by several other names in horticulture.Davis, P.H. (ed.) (1984). Flora of Turkey and the East Aegean Islands 8: 1-632. Edinburgh University Press, Edinburgh.Rechinger, K.H., Browicz, K., Persson, K. & Wendelbo, P. (1990). Flora Iranica 165: 1-194. Naturhistorisches Museums Wien.Everett, D. (2013). The genus Tulipa Tulips of the world: 1-380. Kew publishing, Kew.Eker, I., Babaç, M.T. & Koyuncu, M. (2014). Revision of the genus Tulipa L. (Liliaceae) in Turkey. Phytotaxa 157: 1-112.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.18 m

Plant height min0.07 m

Life cycle & reproduction5

Flowering endApr

Flowering startApr

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTDry slopes

Woodinessnon-woody

03Chemical composition7 compounds

Compounds documented for Tulipa humilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Fatty acyl glycosides of mono- and disaccharides3

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
6-Tuliposide A	present	LOTUS
6-Tuliposide B	present	LOTUS
[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(4-hydroxy-2-methylidenebutanoyl)oxyoxan-2-yl]methyl (3S)-3,4-dihydroxy-2-methylidenebutanoate	present	LOTUS
alpha-Methylene butyrolactone	present	LOTUS
Tulipalin B	present	LOTUS
Tuliposide A	present	LOTUS
Tuliposide D	present	LOTUS

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulipa humilis has left across the world's sequence archives.

At a glance

DNA specimens29

Marker genes4

GenBank sequences10

eDNA detections42

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH555295.1 ↗674 bp

ACGT

GTGAACCTGCGGAAGGATTGTTGTCGATGTCCGATCGAAAGACTGTGAACTTGTAAACGGATGCCACCAGGGGTGTCGGGCTAGCTCCAC …

Tulipa humilis var. kurdica voucher RNG:H.O.M Sarthis HOMS-005_SH2B internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★ITS8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Tulipa humilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size29 846 115 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Tulipa humilis29.85 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode18records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2418×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Yoshida, M. 1980. Karyotype analysis in Tulipa XIV. Tottori-daigaku Iry;amogijutsu Tankidaigakubu Kenky;amu H;amokoku. 4: 23–34. (In Japanese).

CCDB · ipcn-api-dl — Raamsdonk, L. W. D. v. & T. d. Vries. 1992. Biosystematic studies in Tulipa sect. Eriostemones (Liliaceae). Pl. Syst. Evol. 179: 26–41.

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1981. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Eriostemones (Liliaceae). Pl. Syst. Evol. 139: 47–55.

CCDB · ipcn-api-dl — Masoud, S., Z. F. Shirin, K. Shadi & Z. Bahram. 2002. Karyotypic study in some Iranian species and populations of Tulipa L. (Liliaceae). Caryologia 55: 81–89.

CCDB · ipcn-api-dl — Daniela, I. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 13–14.

CCDB · book-ipcn67-71 — SOUTHERN, D. I. 1967. Species relationships in the genus Tulipa. Chromosoma 23: 80-94.

CCDB · book-ipcn73-74 — HOLITSCHER, Q. 1972. Pruhonicky sortiment tulipanu. Acta Pruhori. 27: 17-48.

CCDB · kew — Southern DI. 1967. Species relationships in genus Tulipa. Chromosoma 23: 80-94.

CCDB · iapt — IAPT/IOPB Chromosome Data 19

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type82 records

Wild obs. + sensor48

Museum / vouchered26

Cultivated / captive8

Origin

Native3

Introduced1

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 21≤1 km 12≤10 km 2>10 km 6

41 georeferenced · 7 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 3≤10 km 4

8 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence26

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 7 without coordinates

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wlocation not on record	7
Moscow State Universitylocation not on record	4
Kew, GB	3
Denver, US	2
Edinburgh, GB	2
Vancouver, CA	1
Columbia, US	1
Auckland, NZ	1
LDlocation not on record	1
SLU Artdatabankenlocation not on record	1
South Kensington, GB	1

11 institutions · 24 of 26 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA42 detections

Where the DNA of Tulipa humilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–10.4

Seasonal swing summer↔winter24.2 °C

Max temp (day)15.7 °C

Min temp (night)3.20 °C

Precipitation42.3 mm/mo

Air humidity54.3 %

Moisture balance-49.4 mm/mo

Vapour deficit708 Pa

Wind speed2.70 m/s

Cloud cover34.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)