Tulipa dasystemon

(Regel) Regel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Tulipa

At a glance

Occurrence records190

Data sources11

Biological traits23

DNA specimens6

eDNA detections4

Sources11 archives

Databases and archives Tulipa dasystemon's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility190 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF190 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB36.9 Gbp

01Narrative

Tulipa dasystemon, synonym Tulipa neustruevae, is a bulbous herbaceous perennial species of tulip (Tulipa) in the family Liliaceae. It belongs to the section Biflores.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf width max10 mm

Leaf width min5 mm

Plant height max0.2 m

Plant height min0.07 m

Seed mass1.76 mg

Seed mass max1.75 mg

Seed mass min1.75 mg

Life cycle & reproduction5

Flowering endJun

Flowering startJun

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max3 200 m

Elevation mean2 500 m

Elevation min1 800 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulipa dasystemon has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOR380817.1 ↗5 847 bpUzbekistan

ACGT

ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACCAATTCATACGGTGAAACTGC …

Tulipa dasystemon isolate Kew7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL7★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tulipa dasystemon carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size36 943 950 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Tulipa dasystemon36.94 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× / 4× cytotypes

Chromosome records24–242n range24median24mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 246×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Zhai, S. h., G. j. Liu & M. x. Li. 1989. The karyotype analysis of Tulipa spp. in Xinjiang. Pp. 95--100 in D. Hong (editor), Plant Chromosome Research 1987.

CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.

CCDB · ipcn-api-dl — Raamsdonk, L. W. D. v. & T. d. Vries. 1992. Biosystematic studies in Tulipa sect. Eriostemones (Liliaceae). Pl. Syst. Evol. 179: 26–41.

CCDB · book-ipcn75-78 — 48

CCDB · book-ipcn75-78 — Bochantseva 1972

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type190 records

Wild obs. + sensor135

Museum / vouchered51

Cultivated / captive4

Origin

Introduced2

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 41≤1 km 39≤10 km 19>10 km 5

104 georeferenced · 31 without coordinates

Open the mapobservation + sensor135

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 6≤10 km 25>10 km 4

35 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence51

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 2 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	39
Uniwersytet Opolskilocation not on record	3
Beijing, CN	1
Kew, GB	1
Saint Louis, US	1
Herbarium of South China Botanical Gardenlocation not on record	1
Institute for Biology of National Academy of Sci.location not on record	1

7 institutions · 47 of 51 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Tulipa dasystemon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 20.1–20.1

Seasonal swing summer↔winter37.5 °C

Max temp (day)26.1 °C

Min temp (night)12.2 °C

Precipitation1.70 mm/mo

Air humidity34.4 %

Moisture balance-129 mm/mo

Vapour deficit1,548 Pa

Wind speed2.40 m/s

Cloud cover26.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)