Tulipa clusiana

Redouté · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Tulipa

At a glance

Occurrence records296

Data sources10

Biological traits12

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Tulipa clusiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility296 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF296 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB21.6 Gbp

01Narrative

Tulipa grey-wilsonii là một loài thực vật có hoa trong họ Liliaceae. Loài này được Rech.f. miêu tả khoa học đầu tiên năm 1990.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max3 800 m

Elevation min900 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulipa clusiana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOR206564.1 ↗714 bpGreece · 2022

ACGT

CATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGGAAGGATCATTGTCGATTGCCTGACCGAAAGACCGTGAA …

Tulipa clusiana isolate a small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tulipa clusiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size21 589 350 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Tulipa clusiana21.59 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy3× triploid · measured

Chromosome records24–602n range24median24mode26records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2415×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +2

CCDB · ipcn-api-dl — Koul, A. K., A. LANGER & B. A. Wafai. 1988. Studies on nucleolus and nucleolar chromosomes in angiosperms VI. Nucleolar organization in genus Tulipa L. (Liliaceae). Cytologia 53: 193–198.

CCDB · ipcn-api-dl — Wafai, B. A. & A. K. Koul. 1983. Some naturally occurring chromosome anomalies in Tulipa clusiana DC. Genetica 60: 157–160.

CCDB · ipcn-api-dl — Masoud, S., Z. F. Shirin, K. Shadi & Z. Bahram. 2002. Karyotypic study in some Iranian species and populations of Tulipa L. (Liliaceae). Caryologia 55: 81–89.

CCDB · ipcn-api-dl — Ghaffari, S. M. 2006. New or rare chromosome counts of some angiosperm species from Iran. Iran. J. Bot. 11(2): 185–192.

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1982. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Leiostemones (Liliaceae). Pl. Syst. Evol. 139: 163–178.

CCDB · book-ipcn75-78 — Sen 1977

CCDB · book-ipcn75-78 — Wafai 1977

CCDB · book-ipcn75-78 — 48

CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.

CCDB · book-ipcn73-74 — SEN, S. 1973. Structural hybridity intra-and interspecific level in Liliales. Folia Biol. (Cracow) 21: 83-197.

CCDB · book-indian_vol2 — Sen, S. 1977

CCDB · book-indian_vol2 — Woods, M.W. & Bamford, R. 1937; Sobti, S.N. & Singh, S.D. 1961 ; Sen, s. 1977

CCDB · book-atlas-flowering-plants

2n 489×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +2

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1982. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Leiostemones (Liliaceae). Pl. Syst. Evol. 139: 163–178.

CCDB · ipcn-api-dl — Pandita, T. K. 1979. Cytological investigations of some monocots of Kashmir. Ph.D. Thesis, Chandigarh 1979.

CCDB · book-ipcn75-78 — Sen 1977

CCDB · book-ipcn73-74 — SEN, S. 1973. Structural hybridity intra-and interspecific level in Liliales. Folia Biol. (Cracow) 21: 83-197.

CCDB · book-indian_vol2 — Malik, C.P. 1961b; .Mehra, P.N. & Pandita, T.K. 1978

CCDB · book-atlas-flowering-plants

2n 361×CCDB · kew

CCDB · kew — Leitch IJ, Beaulieu JM, Cheung K, Hanson L, Lysak M, Fay MF. 2007. Punctuated genome size evolution in Liliaceae. Journal of Evolutionary Biology 20: 2296-2308.

2n 601×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Athanasiou, K. 1988. Some cytogeographical notes on the genus Tulipa L. (Liliaceae). Bot. Chron. (Patras) 8: 51–59.

n 242×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Wafai, B. A. & A. Goul. 1986. Karyotype analysis of Himalayan tulips. A prelude to taxonomic rearrangement within subsection Clusianae (Genus Tulipa L.). Rev. Biol., Rev. Brasil. & Portug. Biol. Geral. 13: 65–73.

CCDB · book-ipcn75-78 — Kaul et al. l 976b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

triploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type296 records

Wild obs. + sensor195

Museum / vouchered94

Other7

Range

Area of Occupancy AOO928 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 66≤1 km 24≤10 km 39>10 km 12

141 georeferenced · 54 without coordinates

Open the mapobservation + sensor195

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤1 km 15≤10 km 6>10 km 26

47 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	32
GMBAlocation not on record	29
Hazara Universitylocation not on record	13
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
Muzaffarabad, PK	3
BDBClocation not on record	2
Auckland, NZ	2
Firenze, IT	1
Berlin, DE	1
Bourges, FR	1
BClocation not on record	1
Santa Barbara, US	1
Coimbra, PT	1

13 institutions · 91 of 94 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Tulipa clusiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 22.0–22.0

Seasonal swing summer↔winter27.8 °C

Max temp (day)27.6 °C

Min temp (night)13.9 °C

Precipitation5.50 mm/mo

Air humidity39.8 %

Moisture balance-124 mm/mo

Vapour deficit1,940 Pa

Wind speed2.40 m/s

Cloud cover21.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)