Tulipa biflora

Pall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Tulipa

At a glance

Occurrence records1 189

Data sources12

Biological traits22

DNA specimens22

eDNA detections22

Sources12 archives

Databases and archives Tulipa biflora's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 189 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF1 189 records

Environmental DNA1 datasets · 1 countries22 detections

DNA & barcodingBOLD · NCBI22 specimens

Genome at a glanceCCDB · GoaT28.4 Gbp

01Narrative

Die Mehrfarbige Tulpe (Tulipa polychroma) ist eine Pflanzenart aus der Gattung der Tulpen (Tulipa) in der Familie der Liliengewächse (Liliaceae). Möglicherweise handelt es sich bei ihr nur um eine Unterart von Tulipa biflora.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max0.4 m

Plant height min0.06 m

Seed mass1.77 mg

Life cycle & reproduction6

Dispersal typewind

Flowering endApr

Flowering startApr

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max3 200 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTdesert, sand, stony places

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition7 compounds

Compounds documented for Tulipa biflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Fatty acyl glycosides of mono- and disaccharides3

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
6-Tuliposide A	present	LOTUS
6-Tuliposide B	present	LOTUS
[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(4-hydroxy-2-methylidenebutanoyl)oxyoxan-2-yl]methyl (3S)-3,4-dihydroxy-2-methylidenebutanoate	present	LOTUS
alpha-Methylene butyrolactone	present	LOTUS
Tulipalin B	present	LOTUS
Tuliposide A	present	LOTUS
Tuliposide D	present	LOTUS

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulipa biflora has left across the world's sequence archives.

At a glance

DNA specimens22

Marker genes4

GenBank sequences10

eDNA detections22

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLOR288477.1 ↗151 982 bpUzbekistan · 2021

ACGT

TTTAATGTTAATGTGTTATGTTACAAAACTAGTGAATCAAACAAAAAAGGGACAATACCCAATATCTTGCTAGAACAAGATATTGGGTAT …

Tulipa biflora voucher 53-1 plastid, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL10★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Tulipa biflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size28 386 450 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Tulipa biflora28.39 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× / 3× / 4× cytotypes

Chromosome records24–242n range24median24mode26records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2426×GoaT · Kew Plant DNA C-values Database · CCDB · fl-europaea · CCDB · ipcn-api-dl +4

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · fl-europaea — Milan, 1975

CCDB · ipcn-api-dl — Raamsdonk, L. W. D. v. & T. d. Vries. 1992. Biosystematic studies in Tulipa sect. Eriostemones (Liliaceae). Pl. Syst. Evol. 179: 26–41.

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1981. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Eriostemones (Liliaceae). Pl. Syst. Evol. 139: 47–55.

CCDB · ipcn-api-dl — Masoud, S., Z. F. Shirin, K. Shadi & Z. Bahram. 2002. Karyotypic study in some Iranian species and populations of Tulipa L. (Liliaceae). Caryologia 55: 81–89.

CCDB · ipcn-api-dl — Danelia, I. M. 1989. On karyosystematics of some Caucasian representatives of the genus Tulipa (Liliaceae). Bot. Žhurn. (Moscow & Leningrad) 74: 193–200.

CCDB · ipcn-api-dl — Borzatti von Löwenstern, A. & F. Garbari. 1999. Mediterranean chromosome number reports 9 (1099--1105). Fl. Medit. 9: 379–387.

CCDB · ipcn-api-dl — Ghaffari, S. M. 2006. New or rare chromosome counts of some angiosperm species from Iran. Iran. J. Bot. 11(2): 185–192.

CCDB · ipcn-api-dl — Zakharjeva, O. I. 1990. <In> A. Takhtajan (editor), Numeri Chromosomatum Magnoliophytorum Florae URSS, Aceraceae--Menyanthaceae. Nauka, Leninopoli

CCDB · book-ipcn67-71 — SOUTHERN, D. I. 1967. Species relationships in the genus Tulipa. Chromosoma 23: 80-94.

CCDB · book-ipcn75-78 — Bochantseva 1972

CCDB · eflora

CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.

CCDB · kew — Southern DI. 1967. Species relationships in genus Tulipa. Chromosoma 23: 80-94.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 189 records

Wild obs. + sensor1 030

Museum / vouchered152

Cultivated / captive7

Origin

Native2

Range

Area of Occupancy AOO2 240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 314≤1 km 89≤10 km 82>10 km 46

531 georeferenced · 499 without coordinates

Open the mapobservation + sensor1 030

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 4≤1 km 32≤10 km 48>10 km 10

94 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence152

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 5 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	90
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	12
Rishon Le Zion, IL	5
Kew, GB	2
Wlocation not on record	2
Edinburgh, GB	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

7 institutions · 114 of 152 vouchered records shown · 37 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA22 detections

Where the DNA of Tulipa biflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–10.4

Seasonal swing summer↔winter24.2 °C

Max temp (day)15.7 °C

Min temp (night)3.20 °C

Precipitation42.3 mm/mo

Air humidity54.3 %

Moisture balance-49.4 mm/mo

Vapour deficit708 Pa

Wind speed2.70 m/s

Cloud cover34.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tulipa biflora

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

Compound class profile1 class

Documented compounds7 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 189 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions3 of 7 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 189 records