Tulipa agenensis

Redouté · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Liliaceae/Tulipa

At a glance

Occurrence records4 136

Data sources10

Biological traits14

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Tulipa agenensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF4 136 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Tulipa libanotica là một loài thực vật có hoa trong họ Liliaceae. Loài này được Regel miêu tả khoa học đầu tiên năm 1888.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.2 m

Seed mass2.58 mg

⚠ sources differ — TRY: 2.58 mg · GIFT: 2.93 mg

Seed mass max2.93 mg

Seed mass min2.93 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition7 compounds

Compounds documented for Tulipa agenensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Fatty acyl glycosides of mono- and disaccharides3

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
6-Tuliposide A	present	LOTUS
6-Tuliposide B	present	LOTUS
[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(4-hydroxy-2-methylidenebutanoyl)oxyoxan-2-yl]methyl (3S)-3,4-dihydroxy-2-methylidenebutanoate	present	LOTUS
alpha-Methylene butyrolactone	present	LOTUS
Tulipalin B	present	LOTUS
Tuliposide A	present	LOTUS
Tuliposide D	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulipa agenensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOR206562.1 ↗707 bpGreece · 2022

ACGT

CATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCCGACCGAAAGACCGTGAACT …

Tulipa agenensis isolate a small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tulipa agenensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records24–362n range36median36mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · fl-europaea — Hall, 1937

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1982. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Leiostemones (Liliaceae). Pl. Syst. Evol. 139: 163–178.

CCDB · book-atlas-flowering-plants

2n 242×CCDB · ipcn-api-dl · CCDB · iapt

CCDB · ipcn-api-dl — Blakey, D. H. & C. G. Vosa. 1982. Heterochromatin and chromosome variation in cultivated species of Tulipa subg. Leiostemones (Liliaceae). Pl. Syst. Evol. 139: 163–178.

CCDB · iapt — IAPT/IOPB Chromosome Data 22

n 241×CCDB · ita-fl

CCDB · ita-fl — BAMBACIONI-MEZZETTI V. - 1931. Nuove ricerche sulla embriologia delle Gigliaceae. Ann. Bot. (Rome) , 19(2): 365-382.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 136 records

Wild obs. + sensor4 047

Museum / vouchered89

Range

Area of Occupancy AOO3 732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 328≤1 km 125≤10 km 103>10 km 20

576 georeferenced · 3 471 without coordinates

Open the mapobservation + sensor4 047

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 2≤1 km 2≤10 km 2>10 km 1

7 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rishon Le Zion, IL	45
BIO-UNIPIlocation not on record	27
Berlin, DE	3
Auckland, NZ	3
Wlocation not on record	2
LDlocation not on record	2
BClocation not on record	2
Firenze, IT	1
Sion, CH	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
MeiseBGlocation not on record	1

11 institutions · 88 of 89 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Tulipa agenensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–10.4

Seasonal swing summer↔winter24.2 °C

Max temp (day)15.7 °C

Min temp (night)3.20 °C

Precipitation42.3 mm/mo

Air humidity54.3 %

Moisture balance-49.4 mm/mo

Vapour deficit708 Pa

Wind speed2.70 m/s

Cloud cover34.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tulipa agenensis

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Compound class profile1 class

Documented compounds7 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 136 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 136 records