Tulbaghia verdoornia — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Tulbaghia

At a glance

Occurrence records0

Data sources5

Biological traits14

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Tulbaghia verdoornia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 12

01Narrative

Tulbaghia verdoornia là một loài thực vật có hoa trong họ Amaryllidaceae. Loài này được Vosa & R.B.Burb. miêu tả khoa học đầu tiên năm 1975.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.3 m

Plant height min0.15 m

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max380 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulbaghia verdoornia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU692182.1 ↗752 bpSouth Africa

ACGT

GAAGTAAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCCGAGAGGAAGAATGCGAACTTGTGATCG …

Tulbaghia verdoornia isolate TVE-44 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tulbaghia verdoornia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–122n range12median12mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 122×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Vosa, C. G. 2000. A revised cytotaxonomy of the genus Tulbaghia (Alliaceae). Caryologia 53: 83–112.

CCDB · book-ipcn75-78 — Vasa 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗