Tulbaghia cominsii

Vosa · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Tulbaghia

At a glance

Occurrence records3

Data sources7

Biological traits14

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Tulbaghia cominsii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF3 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 12

01Narrative

Tulbaghia cominsii là một loài thực vật có hoa trong họ Amaryllidaceae. Loài này được Vosa miêu tả khoa học đầu tiên năm 1979.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.2 m

Plant height min0.09 m

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max365 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulbaghia cominsii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU692154.1 ↗685 bpSouth Africa

ACGT

TGAACCTGCGGAAGGATCATTGTCGATGCCCGAGAGGAAGAATGCGAACTTGTGATCGCGCCCTTCGGGAGCGGAGGCGGCGGCGGCCGC …

Tulbaghia cominsii isolate TCO-16 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tulbaghia cominsii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–122n range12median12mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 122×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Vosa, C. G. 2000. A revised cytotaxonomy of the genus Tulbaghia (Alliaceae). Caryologia 53: 83–112.

CCDB · ipcn-api-dl — Vosa, C. G. 1979b. Notes on Tulbaghia. I. A new species from the eastern Cape and a list of new localities. J. S. African Bot. 45: 127–132.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 records

Wild obs. + sensor3

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)