Tulbaghia capensis

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Tulbaghia

At a glance

Occurrence records241

Data sources9

Biological traits19

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Tulbaghia capensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility241 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF241 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 12

01Narrative

تولباغية رأس الرجاء هي نوع من النباتات يتبع جنس التولباغية من الفصيلة النرجسية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.34 m

Plant height min0.11 m

Seed mass3.11 mg

Seed mass max3.66 mg

Seed mass min2.55 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min10 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulbaghia capensis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences6

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392237.1 ↗581 bp

ACGT

TCGATGCCTGGAGGAAGAATGCGAACTTGTGATCGAGCCCTTCTGGAGCGGAGGCAGCAGCGGCCGCGTCGCACGCCCATGCTCCCCTGG …

Tulbaghia capensis voucher Muasya & Zhigila 7892 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tulbaghia capensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–362n range12median12mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 126×CCDB · book-ipcn65 · CCDB · book-ipcn75-78 · CCDB · Cave1956supp +2

CCDB · book-ipcn65 — Smith & F. 1965

CCDB · book-ipcn75-78 — 36

CCDB · book-ipcn75-78 — Vasa 1975

CCDB · Cave1956supp — Whitaker & Flory 155

CCDB · Cave1958 — Riley & Hoff 1958

CCDB · Cave1963 — Dyer 1963

2n 361×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — VOSA, C. G. 1966. Chromosome variation in Tulbaghia. Heredity 21: 305-321.

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — VOSA, C. G. 1966. Chromosome variation in Tulbaghia. Heredity 21: 305-321.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type241 records

Wild obs. + sensor191

Museum / vouchered50

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 118≤1 km 21≤10 km 2>10 km 13

154 georeferenced · 37 without coordinates

Open the mapobservation + sensor191

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 50 records without

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	29
Cape Town, ZA	14
MSB-3054location not on record	5
South African National Biodiversity Institutelocation not on record	1
Berlin, DE	1

5 institutions · 50 of 50 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Tulbaghia capensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)