Tulbaghia alliacea

L.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Tulbaghia

At a glance

Occurrence records219

Data sources8

Biological traits24

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Tulbaghia alliacea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility219 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF219 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 12

01Narrative

تولباغية ثومية هي نوع من النباتات يتبع جنس التولباغية من الفصيلة النرجسية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.3 m

Plant height max0.44 m

Plant height min0.25 m

Seed mass2.39 mg

Seed mass max3.01 mg

Seed mass min0.88 mg

Life cycle & reproduction6

Deciduousnessdeciduous

Life formbulbous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 250 m

Elevation mean2 600 m

Elevation min50 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulbaghia alliacea has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU692147.1 ↗658 bpSouth Africa

ACGT

TGCGAACTTGTGATCGCGCCCTTCGGGAGCGGAGGCGGCGGCGGCTTGCGCCGCACCCCCTCGCTCCCCTGGGCCCCCCTGCTGCCCCCG …

Tulbaghia alliacea isolate TAL-9 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tulbaghia alliacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–242n range12median12mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 123×CCDB · book-ipcn65 · CCDB · book-ipcn75-78 · CCDB · Cave1963

CCDB · book-ipcn65 — Smith & F. 1965

CCDB · book-ipcn75-78 — 36

CCDB · Cave1963 — Dyer 1963

2n 242×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — VOSA, C. G. 1966. Chromosome variation in Tulbaghia. Heredity 21: 305-321.

CCDB · book-ipcn67-71 — WILSENACH, R. 1967. On the karyology and phylogeny of Tulbaghia. Plant Life 23: 75-83.

n 122×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — VOSA, C. G. 1966. Chromosome variation in Tulbaghia. Heredity 21: 305-321.

CCDB · book-ipcn67-71 — WILSENACH, R. 1967. On the karyology and phylogeny of Tulbaghia. Plant Life 23: 75-83.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type219 records

Wild obs. + sensor134

Museum / vouchered85

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 106≤1 km 9≤10 km 1>10 km 1

117 georeferenced · 17 without coordinates

Open the mapobservation + sensor134

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence85

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	20
Saint Louis, US	12
MSB-3054location not on record	7
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	6
Cape Town, ZA	5
South African National Biodiversity Institutelocation not on record	2
Moscow State Universitylocation not on record	1
Durban, ZA	1
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	1
GHPG$location not on record	1
University of Johannesburglocation not on record	1
Philadelphia, US	1
Kew, GB	1
University of Cape Townlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

15 institutions · 61 of 85 vouchered records shown · 24 without an institution code

09Environmental DNA3 detections

Where the DNA of Tulbaghia alliacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 13.7–13.7

Seasonal swing summer↔winter7.50 °C

Max temp (day)16.5 °C

Min temp (night)11.0 °C

Precipitation111 mm/mo

Air humidity59.2 %

Moisture balance62.6 mm/mo

Vapour deficit634 Pa

Wind speed2.70 m/s

Cloud cover10.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)