Tulbaghia acutiloba

Harv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Tulbaghia

At a glance

Occurrence records410

Data sources8

Biological traits16

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Tulbaghia acutiloba's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility410 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF410 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 12

01Narrative

تولباغية حادة الفلقات هي نوع من النباتات يتبع جنس التولباغية من الفصيلة النرجسية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max0.2 m

Plant height min0.11 m

Seed mass1.73 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 530 m

Elevation min100 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tulbaghia acutiloba has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU692144.1 ↗584 bpSouth Africa

ACGT

ATGCGAACTTGTGATCGCGCCCTTCGGGAGCGGCGGCGGCGGCGGCTTGGGCCGCACCCCCTCGCTCCCCTGGCCCCCCTGCTGCCCCCG …

Tulbaghia acutiloba isolate TAC-6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tulbaghia acutiloba carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–142n range12median12mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 124×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Vosa, C. G. 2000. A revised cytotaxonomy of the genus Tulbaghia (Alliaceae). Caryologia 53: 83–112.

CCDB · ipcn-api-dl — Vosa, C. G. 1979b. Notes on Tulbaghia. I. A new species from the eastern Cape and a list of new localities. J. S. African Bot. 45: 127–132.

CCDB · book-ipcn67-71 — VOSA, C. G. 1966. Chromosome variation in Tulbaghia. Heredity 21: 305-321.

CCDB · book-ipcn75-78 — Vosa 1975

2n 141×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — WILSENACH, R. 1967. On the karyology and phylogeny of Tulbaghia. Plant Life 23: 75-83.

n 61×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — VOSA, C. G. 1966. Chromosome variation in Tulbaghia. Heredity 21: 305-321.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type410 records

Wild obs. + sensor208

Museum / vouchered202

Range

Area of Occupancy AOO1 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 111≤1 km 25≤10 km 8>10 km 8

152 georeferenced · 56 without coordinates

Open the mapobservation + sensor208

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 202 records without

Open the institutions mapphysical evidence202

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	132
Durban, ZA	55
MSB-3054location not on record	4
Cape Town, ZA	3
LNBG$location not on record	3
Bronx, US	1
University of Stellenboschlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

8 institutions · 200 of 202 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Tulbaghia acutiloba was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)