Tubulanus superbus

(Kölliker, 1845) · species

image placeholder — illustration coming later

Animalia/Nemertea/Palaeonemertea/Tubulanidae/Tubulanus

At a glance

Occurrence records244

Data sources8

Biological traits2

DNA specimens4

eDNA detections3

Sources8 archives

Databases and archives Tubulanus superbus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility120 records↗

OBISOcean Biodiversity Information System124 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS244 records

Environmental DNA1 datasets · 3 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Tubulanus superbus, commonly known as the football jersey worm, is a species of ribbon worm in the phylum Nemertea. Found in the northern Atlantic Ocean, the North Sea and the Mediterranean Sea, it occurs from the lower shore down to about 80 m, on sand or gravel.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tubulanus superbus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections3

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.51%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 5 variable positions, in barcode order

100Tvariable

373Tvariable

412Cvariable

544Avariable

578Tvariable

AACTCTTTATTTTATTTTTGGTGTTTGATCTGGTCTTGTTGGTACTGCTTTGAGGATGTTAATTCGTGCTGAGTTAGGTCAACCTGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tubulanus polymorphussame genus12.6%Tubulanus sexlineatussame genus13.7%Tubulanus punctatussame genus14.7%Carinina chocolatasame order16.4%Tubulanus rubersame genus16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type244 records

Wild obs. + sensor102

Museum / vouchered112

Other30

Range

Area of Occupancy AOO432 km²

Depth

0–200 m sunlit61

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 18.3 m · max 214 m · 63 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 80≤1 km 10≤10 km 7>10 km 1

98 georeferenced · 4 without coordinates

Open the mapobservation + sensor102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEFASlocation not on record	9
Gothenburg, SE	3
Bergen, NO	2
DASSHlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Copenhagen, DK	1
South Kensington, GB	1
Frankfurt am Main	1

8 institutions · 19 of 112 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Tubulanus superbus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map3 countries0

Broken shellSoft bottom, gravel, red algae and shells

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 7.60–14.3

Seasonal swing summer↔winter15.8 °C

Max temp (day)15.1 °C 9.20–16.3

Min temp (night)7.30 °C 2.80–12.2

Precipitation92.8 mm/mo 79.7–94.2

Air humidity63.4 % 62.7–64.5

Moisture balance-8.00 mm/mo -9.00–3.60

Vapour deficit552 Pa 399–592

Wind speed4.60 m/s 4.10–5.90

Cloud cover60.1 % 45.5–60.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)