Tubuca urvillei

(H.Milne Edwards, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Ocypodidae/Tubuca

At a glance

Occurrence records143

Data sources7

Biological traits2

DNA specimens26

eDNA detections14

Sources7 archives

Databases and archives Tubuca urvillei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility110 records↗

OBISOcean Biodiversity Information System33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS143 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD26 specimens

01Narrative

Tubuca urvillei is a species of fiddler crab. It is found in the Southeastern Africa from southern Somalia to the South Africa and Madagascar. Tubuca urvillei was formerly a member of the genus Uca, but in 2016 it was placed in the genus Tubuca, a former subgenus of Uca.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat brackishyes

Habitat zonebenthic

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tubuca urvillei has left across the world's sequence archives.

At a glance

DNA specimens26

BINs3

Marker genes2

eDNA detections14

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P663 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

61Tvariable

84Tvariable

108Cvariable

117Cvariable

162Cvariable

168Avariable

171Gvariable

174Tvariable

198Cvariable

267Avariable

288Cvariable

345Cvariable

351Cvariable

366Cvariable

375Gvariable

378Gvariable

433Tvariable

489Gvariable

492Avariable

516Gvariable

555Tvariable

573Cvariable

612Cmostly conserved

630Avariable

639Cvariable

ATTGGTACATTATATTTTATTTTTGGAGCTTGAGCAGGAATAGTAGGAACATCCCTAAGATTAATTATTCGAGCAGAATTAAGTCAACCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes3

BINs3

Most divergent pair3.9%

AsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tubuca alcockisame genus3.6%Tubuca paradussumierisame genus10.2%Tubuca typhonisame genus11.1%Tubuca capricornissame genus11.6%Tubuca longidigitumsame genus11.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type143 records

Wild obs. + sensor137

Museum / vouchered5

Other1

Range

Area of Occupancy AOO340 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 0 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 48≤1 km 15≤10 km 11>10 km 6

80 georeferenced · 57 without coordinates

Open the mapobservation + sensor137

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	2
IEO-CDlocation not on record	1
	1

3 institutions · 4 of 5 vouchered records shown · 1 without an institution code

09Environmental DNA14 detections

Where the DNA of Tubuca urvillei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

Mangrove

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 24.8–25.0

Seasonal swing summer↔winter6.40 °C

Max temp (day)26.2 °C 26.2–26.3

Min temp (night)22.9 °C 22.9–23.3

Precipitation113 mm/mo 112–113

Air humidity62.8 % 62.6–62.8

Vapour deficit1,157 Pa 1,157–1,185

Cloud cover30.8 % 29.4–30.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)