Tuberaria guttata
(L.) Fourr. · speciesAt a glance
Occurrence records35 747
Data sources10
Biological traits55
DNA specimens10
eDNA detections7
Sources10 archives
Databases and archives Tuberaria guttata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility35 747 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics10 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources55 traits
Occurrence & distributionGBIF35 747 records
Environmental DNA1 datasets · 2 countries7 detections
DNA & barcodingBOLD · NCBI10 specimens
Genome at a glanceCCDB · GoaT3.8 Gbp
01Narrative
L'Hélianthème taché, aussi appelé Tubéraire à gouttes ou Hélianthème à gouttes est une petite plante annuelle aux feuilles tomenteuses de la famille des Cistacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology18
Fruit length max5 mm
Fruit length min3 mm
Leaf length max60 mm
Leaf length min10 mm
Leaf size32 mm²
Leaf width max15 mm
Leaf width min5 mm
Plant height0.133 m
⚠ sources differ — GIFT: 0.133 m · LEDA: 0.16 m · TRY: 0.129 m
Plant height generative0.176 m
Plant height max0.4 m
Plant height min0.05 m
Seed length0.577 mm
Seed mass0.062 mg
⚠ sources differ — TRY: 0.062 mg · LEDA: 0.11 mg · GIFT: 1.49 mg
Seed mass max2.87 mg
Seed mass min2.87 mg
Seed volume2.7 mm³
Seed volume max2.7 mm³
Seed volume min2.7 mm³
Life cycle & reproduction18
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colouryellow
Flower length max10 mm
Flower length min6 mm
Flower width max20 mm
Flowering endAug
Flowering startMar
Life formannual
Life spanannual
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number60
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Leaf formelliptic
Mycorrhiza type0.011851194
Woodinessnon-woody
Physiology & chemistry5
Leaf C:N ratio20.03 g/g
Leaf dry-matter content (LDMC)153 mg/g
Photosynthetic pathwayC3
Seed longevity index0.25
Specific leaf area (SLA)22.42 mm²/mg
Other traits2
Diaspore typeseed
Leaf arrangementrosette
05DNA & barcoding10 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tuberaria guttata has left across the world's sequence archives.
At a glance
DNA specimens10
Marker genes5
GenBank sequences7
eDNA detections7
Countries2
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCAACGTCGCCCCCTC …
Tuberaria guttata voucher PLT.0138 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★trnL-F★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Tuberaria guttata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 814 200 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Tuberaria guttata3.81 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidypolyploid inferred
Chromosome records20–482n range36median36mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3615×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · nw-europe-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Proctor, M.C.F. Watsonia 3: 154-159 (1955)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2160
CCDB · fl-europaea — Proctor, 1955
CCDB · ipcn-api-dl — LOON VAN, J. C. & H. D. JONG. 1978. In IOPB chromosome number reports LIX. Taxon 27: 53–61.
CCDB · ipcn-api-dl — Leitao, M. T. & M. C. ALVES. 1976. Contribuicao para o conhecimento citotaxonomico das Spermatophyta de Portugal. Cistaceae. Bol. Soc. Brot., sér. 2 50: 247–263.
CCDB · book-ipcn75-78 — Loon & Jong 1978
CCDB · book-ipcn75-78 — Leitao & Alves 1976
CCDB · book-fedorov — Proctor 1954, 1955, 1960
CCDB · book-atlas-flowering-plants — Proctor 1955
CCDB · CromoCat 2015 — Kerguélen, M. (1998). Index synonymique de la Flore de France INRA-MNHN Dijon
CCDB · CromoCat 2015 — Leitao, M. T. & Alves, M. C. (1976). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XIV. Cistaceae. Bol. Soc. Brot. 50: 247-263.
CCDB · CromoCat 2015 — Loon van, J. C. & de Jong, H. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIX]. Taxon 27(1): 56-61.
CCDB · CromoCat 2015 — Proctor, M. C. F. (1955). Some chromosome counts in the European Cistaceae. Watsonia 3(3): 154-159.
CCDB · CromoCat 2015 — Sánchez Anta, M. A., F. Gallego Martín & F. Navarro Andrés. (1986). Aportaciones al conocimiento cariológico de las Cistáceas del Centro-Occidente español. Stud. Bot. Univ. Salamanca 5: 195-202.
2n 2412×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +3
CCDB · ita-fl — ROMANO S., COLOMBO P., MARCEN C. - 1992 (1991). Numeri cromosomici per la flora italiana: 1273-1283.. Inform. Bot. Ital. , 23(2-3): 123-132.
CCDB · ipcn-api-dl — Van Loon, J. C. & J. J. M. H. OUDEMANS. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 343–344.
CCDB · ipcn-api-dl — Romano, S., P. Colombo & C. Marcenó. 1991. Numeri cromosomici per la flora Italiana: 1273--1283. Inform. Bot. Ital. 23: 123–130.
CCDB · ipcn-api-dl — Humphries, C. J., B. G. Murray, G. Bocquet & K. N. Vasudevan. 1978. Chromosome numbers of phanerogams from Morocco and Algeria. Bot. Not. 131: 391–404.
CCDB · ipcn-api-dl — Markova, M. 1975. Karyosystematic studies in the Cistaceae of Bulgaria. Pl. Syst. Evol. 123: 283–315.
CCDB · ipcn-api-dl — Gallego, M. J. & A. Aparicio. 1993. Karyological study in the genus Tuberaria sect. Scorpioides (Cistaceae): taxonomic and evolutionary inferences. Pl. Syst. Evol. 184: 11–25.
CCDB · book-ipcn72 — MARKOVA, M.L. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · book-fedorov — Atsmon, Feinbrun 1960
CCDB · CromoCat 2015 — Loon van, J. C. & Oudemans, J. J. M. H. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 343-344.
CCDB · CromoCat 2015 — Markova, M. (1972b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVI]. Taxon 21(2/3): 339.
CCDB · CromoCat 2015 — Markova, M. (1975). Karyosystematische untersuchungen an den Cistaceae Bulgariens. Pl. Syst. Evol. 123: 283-315.
2n 204×CCDB · iber-fl · CCDB · book-fedorov
CCDB · iber-fl — Cromosomas de plantas de la estepa de Aragn, III. Lorenzo Andreu, A.Anales Estac. Exp. Aula Dei2: 195-203(1951).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 92-99. Valds Bermejo, E.Anales Jard. Bot. Madrid38(1): 259-263(1982).
CCDB · book-fedorov — Lorenzo-Andreu 195!
CCDB · book-fedorov — Bowden 1940a
2n 482×CCDB · book-fedorov · CCDB · CromoCat 2015
CCDB · book-fedorov — Chiarugi 1925
CCDB · CromoCat 2015 — Chiarugi, A. (1925). Embriologia della Cistaceae. Nuovo Giorn. Bot. Ital. 32: 223-314.
n 125×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Luque, T. & J. A. Mejías. 1986. Números cromosómicos parala flora Española, 491--496. Lagascalia 14: 301–304.
CCDB · ipcn-api-dl — Schotsman, H. D. 1974. Nouvelle localité, aux Iles Canaries, d'une race chromosomique a n = 12 chez Tuberaria guttata (L.) Fourr. Bull. Centr. Etudes Rech. Sci. 10: 317–320.
CCDB · ipcn-api-dl — Gallego, M. J. & A. Aparicio. 1993. Karyological study in the genus Tuberaria sect. Scorpioides (Cistaceae): taxonomic and evolutionary inferences. Pl. Syst. Evol. 184: 11–25.
CCDB · CromoCat 2015 — Luque, T. & Mejías, J. A. (1986). Números cromosómicos para la flora española, 491-496. Lagascalia 14(2): 301-304.
CCDB · CromoCat 2015 — Schotsman, H. D. (1973). Deux races chromosomiques dans une population de Tuberaria guttata (L.) Fourr. à Gran Canaria (Iles Canaries). Bull. Centr. Etudes Rech. Sci. 9: 235–241
n 185×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Gallego Cidoncha, M. J. 1985. Números 404-408, in Números cromosómicos para la flora española. 363-434. Lagascalia 13: 311–313.
CCDB · CromoCat 2015 — Gallego, M. J. & Aparicio, A. (1993). Karyological study in the genus Tuberaria sect. Scorpioides (Cistaceae): taxonomic and evolutionary inferences. Pl. Syst. Evol. 184: 11-25.
CCDB · CromoCat 2015 — Gallego, M. J. (1985). Números cromosómicos para la flora española, 404-408. Lagascalia 13(2): 311-313.
CCDB · CromoCat 2015 — Sánchez Anta, M. A., F. Gallego Martín & F. Navarro Andrés. (1986). Aportaciones al conocimiento cariológico de las Cistáceas del Centro-Occidente español. Stud. Bot. Univ. Salamanca 5: 195-202.
CCDB · CromoCat 2015 — Vogt, R. & A. Aparicio. (1999). Chromosome numbers of plants collected during Iter Mediterraneum IV in Cyprus Bocconea, Monographiae Herbarii Mediterranei Panormitani 11: 117-169
n 244×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gallego, M. J. & Aparicio, A. (1993). Karyological study in the genus Tuberaria sect. Scorpioides (Cistaceae): taxonomic and evolutionary inferences. Pl. Syst. Evol. 184: 11-25.
CCDB · CromoCat 2015 — Schotsman, H. D. (1973). Deux races chromosomiques dans une population de Tuberaria guttata (L.) Fourr. à Gran Canaria (Iles Canaries). Bull. Centr. Etudes Rech. Sci. 9: 235–241
CCDB · CromoCat 2015 — Schotsman, H. D. (1974). Nouvelle localité, aux Iles Canaries, d'une race chromosomique a n = 12 chez Tuberaria guttata (L.) Fourr. Bull. Centr. Etudes Rech. Sci. 10: 317–320
CCDB · CromoCat 2015 — Vogt, R. & A. Aparicio. (1999). Chromosome numbers of plants collected during Iter Mediterraneum IV in Cyprus Bocconea, Monographiae Herbarii Mediterranei Panormitani 11: 117-169
n 101×CCDB · iber-fl
CCDB · iber-fl — Cromosomas de plantas de la estepa de Aragn, III. Lorenzo Andreu, A.Anales Estac. Exp. Aula Dei2: 195-203(1951).
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.956 ↗
08Occurrence & distribution
Record type35 747 records
Wild obs. + sensor34 132
Museum / vouchered1 548
Cultivated / captive1
Other66
Origin
Native488
Introduced5
Range
Area of Occupancy AOO51 008 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy40% within 1 km
≤100 m 8 365≤1 km 2 428≤10 km 15 637>10 km 416
26 846 georeferenced · 7 286 without coordinates
Open the mapobservation + sensor34 132
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 46≤1 km 149≤10 km 285>10 km 7
487 georeferenced · 1 061 without coordinates
Open the institutions mapphysical evidence1 548
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions44 of 77 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 351 |
| València, ES | 129 |
| ISAlocation not on record | 113 |
| Berlin, DE | 104 |
| LDlocation not on record | 104 |
| BClocation not on record | 77 |
| Barcelona, ES | 68 |
| South Kensington, GB | 66 |
| Entomological Society of Latvialocation not on record | 52 |
| Vitoria, ES | 49 |
| Badajoz, ES | 42 |
| Wlocation not on record | 20 |
| BRNUlocation not on record | 16 |
| Alicante, ES | 15 |
| Salamanca, ES | 15 |
| Córdoba, ES | 14 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 13 |
| San Sebastián, ES | 12 |
| Granada, ES | 10 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 9 |
| Frankfurt am Main | 8 |
| MAlocation not on record | 7 |
| Santiago de Compostela, ES | 7 |
| Davis, US | 6 |
| Sevilla, ES | 6 |
| MeiseBGlocation not on record | 6 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| Oskarshamn, SE | 5 |
| Hunan Geological Museumlocation not on record | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Riverside, US | 4 |
| Rishon Le Zion, IL | 4 |
| Pamplona, ES | 4 |
| Pamplona, ES | 3 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Provincia di Livornolocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Helsinki, FI | 2 |
| Stockholm, SE | 2 |
| Uppsala, SE | 2 |
| Santa Barbara, US | 2 |
| Paris, FR | 2 |
| Gijón, ES | 2 |
| CIBIOlocation not on record | 2 |
| Bourges, FR | 2 |
| Claremont, US | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Dresden, DE | 2 |
| GJOlocation not on record | 2 |
| IPE-CSIClocation not on record | 1 |
| Brussel, BE | 1 |
| Kew, GB | 1 |
| Chongqing Museumlocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Turku, FI | 1 |
| Banyoles, ES | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Monastir, TN | 1 |
| Porrentruy, CH | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Saint Louis, US | 1 |
| Tilburg, NL | 1 |
| Turlock, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Arcata, US | 1 |
| WTUlocation not on record | 1 |
| Columbia, US | 1 |
| Oswego, US | 1 |
| San Luis Obispo, US | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Xiamen, CN | 1 |
| San Diego, US | 1 |
77 institutions · 1 418 of 1 548 vouchered records shown · 128 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA7 detections
Where the DNA of Tuberaria guttata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map2 countries0
Greenhouse grown from seed obtained through …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 12.1–15.4
Seasonal swing summer↔winter15.3 °C
Max temp (day)20.4 °C 13.4–20.5
Min temp (night)10.4 °C 9.50–10.8
Precipitation68.5 mm/mo 58.0–70.4
Air humidity57.7 % 56.9–63.3
Moisture balance-28.0 mm/mo
Vapour deficit789 Pa 518–804
Wind speed2.90 m/s
Cloud cover41.2 % 39.4–45.7
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.