Tubastraea tagusensis

Wells, 1982 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Scleractinia/Dendrophylliidae/Tubastraea

At a glance

Occurrence records239

Data sources8

Biological traits2

DNA specimens9

eDNA detections2

Sources8 archives

Databases and archives Tubastraea tagusensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

OBISOcean Biodiversity Information System188 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS239 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD9 specimens

01Narrative

Tubastraea tagusensis is a hard coral species in the family Dendrophylliidae. The species is azooxanthellate, thus does not need sunlight for development, and does not form reefs. It is native to the Galapagos Islands but has become invasive along the Atlantic coast of South America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tubastraea tagusensis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

76Cmostly conserved

TACGTTATATTTAGTATTTGGGATTGGGGCAGGTATGCTCGGCACGGCCTTCAGTATGCTAATAAGATTAGAGCTCTCGGCTCCGGGGGC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_030352 ↗ · 13 protein · 2 tRNA · 2 rRNA

ND5ND1CYTBND2ND6ATP6ND4COX3COX2ND4LND3ATP8COX1rnsrnl

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type239 records

Wild obs. + sensor50

Museum / vouchered188

Other1

Range

Area of Occupancy AOO212 km²

Depth

0–200 m sunlit66

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2 m · max 30 m · 66 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 15≤1 km 15≤10 km 2

32 georeferenced · 18 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 187 without coordinates

Open the institutions mapphysical evidence188

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	4
Washington, US	4
Puerto Ayora, EC	1

3 institutions · 9 of 188 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Tubastraea tagusensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)