Tubastraea micranthus

(Ehrenberg, 1834) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Anthozoa/Scleractinia/Dendrophylliidae/Tubastraea

At a glance

Occurrence records1 084

Data sources9

Biological traits2

DNA specimens55

eDNA detections14

Sources9 archives

Databases and archives Tubastraea micranthus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility906 records↗

OBISOcean Biodiversity Information System178 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF · OBIS1 084 records

Environmental DNA1 datasets · 0 countries14 detections

DNA & barcodingBOLD55 specimens

01Narrative

Tubastraea micranthus is a species of corals belonging to the family Dendrophylliidae. The species is found in Indian and Pacific Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

03Chemical composition2 compounds

Compounds documented for Tubastraea micranthus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Chromones1

Scalarane sesterterpenoids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
[(3R,4S)-4-[7-(4-bromobenzoyl)oxy-5-hydroxy-2-methyl-4-oxochromen-8-yl]-1-methylpiperidin-3-yl] 4-bromobenzoate		present	LOTUS
Heteronemin		present	LOTUS

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tubastraea micranthus has left across the world's sequence archives.

At a glance

DNA specimens55

BINs1

Marker genes3

eDNA detections14

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P601 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes2

BIN1

Most divergent pair0.50%

Where individuals differ — all 1 variable positions, in barcode order

439Cmostly conserved

TATGCTCGGCACGGCCTTCAGTATGCTAATAAGATTAGAGCTCTCGGCTCCGGGGGCTATGTTAGGAGACGATCATCTTTATAATGTAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Balanophyllia eleganssame family3.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-5P

animal barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_056883 ↗ · 13 protein · 2 tRNA · 2 rRNA

ND5ND1CYTBND2ND6ATP6ND4COX3COX2ND4LND3ATP8COX116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 084 records

Wild obs. + sensor903

Museum / vouchered152

Cultivated / captive2

Other27

Range

Area of Occupancy AOO2 508 km²

Depth

0–200 m sunlit57

200–1000 m twilight6

1–4 km midnight0

>4 km abyssal0

median 14 m · max 250 m · 63 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 188≤1 km 277≤10 km 102>10 km 101

668 georeferenced · 235 without coordinates

Open the mapobservation + sensor903

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 34≤1 km 26≤10 km 9>10 km 2

71 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence152

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	32
Washington, US	13
Paris, FR	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
Sydney, AU	6
CASlocation not on record	4
Western Australian Museumlocation not on record	4
Queensland Museumlocation not on record	2
Frankfurt am Main	2
Museum and Art Gallery of the Northern Territorylocation not on record	1
BIKlocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
National Marine Biodiversity Institute of Korealocation not on record	1

13 institutions · 80 of 152 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Tubastraea micranthus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tubastraea micranthus

At a glance

Sources9 archives

Habitat & environment2

Compound class profile2 classes

Documented compounds2 total

At a glance

Record type1 084 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions5 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 084 records