Tsinilla lineana

(Fernald, 1901) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Tsinilla

At a glance

Occurrence records4

Data sources7

Biological traits0

DNA specimens30

eDNA detections29

Sources7 archives

Databases and archives Tsinilla lineana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 records

Environmental DNA1 datasets · 1 countries29 detections

DNA & barcodingBOLD30 specimens

01Narrative

Tsinilla lineana is een vlinder uit de familie van de bladrollers (Tortricidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1901 door Fernald.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tsinilla lineana has left across the world's sequence archives.

At a glance

DNA specimens30

BINs2

Marker genes1

eDNA detections29

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BINs2

Most divergent pair0.30%

Where individuals differ — all 2 variable positions, in barcode order

136Cmostly conserved

283Gmostly conserved

AACAATATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGTACATCTTTAAGACTTTTAATTCGAGCTGAATTAGGAAACCCAGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hedya prunianasame family8.7%Syricoris rivulanasame family8.7%Nola socotrensissame order8.7%Hermenias rivuliferasame family9.0%Epinotia nigralbanasame family9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 records

Wild obs. + sensor1

Museum / vouchered3

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	3

1 institutions · 3 of 3 vouchered records shown

09Environmental DNA29 detections

Where the DNA of Tsinilla lineana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 23.1–25.8

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.9 °C 25.8–29.5

Min temp (night)22.1 °C 20.7–25.0

Precipitation325 mm/mo 33.5–764

Air humidity70.2 % 60.3–75.5

Moisture balance167 mm/mo -102–611

Vapour deficit883 Pa 743–1,308

Wind speed2.10 m/s 1.20–4.60

Cloud cover32.0 % 18.9–47.2

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)