Trypocopris pyrenaeus

(Charpentier, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Geotrupidae/Trypocopris

At a glance

Occurrence records4 343

Data sources9

Biological traits2

DNA specimens40

eDNA detections6

Sources9 archives

Databases and archives Trypocopris pyrenaeus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 343 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 343 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD40 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

Trypocopris pyrenaeus is a species of dor beetles.Catalogue of life

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)coprophagous

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypocopris pyrenaeus has left across the world's sequence archives.

At a glance

DNA specimens40

BINs5

Marker genes3

eDNA detections6

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 97 variable positions, in barcode order

4Tmostly conserved

8Amostly conserved

9Tmostly conserved

11Tmostly conserved

15Amostly conserved

17Tmostly conserved

19Gmostly conserved

20Gmostly conserved

21Avariable

22Tvariable

23Cvariable

24Cmostly conserved

25Tvariable

26Gvariable

27Avariable

28Gvariable

29Cvariable

30Avariable

31Gvariable

33Avariable

36Avariable

39Amostly conserved

48Cmostly conserved

58Cmostly conserved

75Amostly conserved

84Cvariable

99Tmostly conserved

156Tmostly conserved

168Amostly conserved

180Amostly conserved

189Gmostly conserved

213Cmostly conserved

219Tmostly conserved

237Tmostly conserved

258Cmostly conserved

262Tvariable

270Tmostly conserved

279Amostly conserved

297Amostly conserved

300Avariable

315Tmostly conserved

327Cmostly conserved

333Cmostly conserved

336Cvariable

342Avariable

345Cmostly conserved

354Avariable

357Tmostly conserved

360Tmostly conserved

361Gmostly conserved

411Cmostly conserved

432Cmostly conserved

462Tvariable

474Amostly conserved

477Amostly conserved

492Avariable

552Amostly conserved

561Avariable

585Cmostly conserved

588Tmostly conserved

610Tmostly conserved

611Tvariable

612Tvariable

613Gvariable

614Avariable

615Cmostly conserved

616Cvariable

617Cvariable

618Gvariable

619Gmostly conserved

620Cvariable

621Thighly variable

622Gmostly conserved

623Gmostly conserved

624Avariable

625Gmostly conserved

626Gvariable

627Gvariable

628Gvariable

629Gvariable

630Tvariable

631Gvariable

632Amostly conserved

634Cmostly conserved

635Cmostly conserved

636Avariable

637Amostly conserved

638Tmostly conserved

639Tvariable

640Tvariable

641Tvariable

642Amostly conserved

643Tmostly conserved

644Avariable

645Cvariable

647Amostly conserved

648Amostly conserved

ACTTTATATTTTTTATTTGGATCCTGAGCAGGAATAGTAGGTACATCCCTTAGAATTCTAATTCGTGCAGAATTAGGAAATCCCGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.0%

Haplotypes3

BINs5

Most divergent pair4.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trypocopris fulgidussame genus7.3%Jekelius brulleisame family10.2%Thorectes hoppeisame family10.2%Jekelius marginatussame family10.8%Jekelius chalconotussame family11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Trypocopris pyrenaeus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Wilson CJ, Angus RB (2004) A chromosome investigation of seven geotrupids and two aegialiine. Nouvelle Revue d'Entomologie 21: 157-170. ↗

08Occurrence & distribution

Record type4 343 records

Wild obs. + sensor3 738

Museum / vouchered491

Fossil2

Other112

Origin

Native3

Range

Area of Occupancy AOO7 548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 650≤1 km 221≤10 km 1 280>10 km 111

2 262 georeferenced · 1 476 without coordinates

Open the mapobservation + sensor3 738

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 3≤1 km 134≤10 km 62

199 georeferenced · 292 without coordinates

Open the institutions mapphysical evidence491

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	249
Vitoria, ES	138
CIBIOlocation not on record	29
Natural History Museum Rotterdamlocation not on record	21
University of Turinlocation not on record	8
Aristotle University of Thessalonikilocation not on record	3
CBDClocation not on record	2
South Kensington, GB	2
NCMGlocation not on record	2
IMEDEAlocation not on record	1
Natural History Museum, Londonlocation not on record	1

11 institutions · 456 of 491 vouchered records shown · 34 without an institution code

09Environmental DNA6 detections

Where the DNA of Trypocopris pyrenaeus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.60 °C 5.00–12.6

Seasonal swing summer↔winter19.9 °C

Max temp (day)11.8 °C 8.40–16.7

Min temp (night)3.50 °C -0.1–7.00

Precipitation92.1 mm/mo 54.6–143

Air humidity58.9 % 55.7–59.8

Moisture balance26.8 mm/mo -22.8–65.0

Vapour deficit494 Pa 381–753

Wind speed1.90 m/s 1.70–2.30

Cloud cover46.0 % 41.4–47.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trypocopris pyrenaeus

At a glance

Sources9 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 343 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 343 records