Trypetoptera punctulata

(Scopoli, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Sciomyzidae/Trypetoptera

At a glance

Occurrence records8 043

Data sources9

Biological traits2

DNA specimens23

eDNA detections106

Sources9 archives

Databases and archives Trypetoptera punctulata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 043 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI106 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF8 043 records

Environmental DNA4 datasets · 7 countries106 detections

DNA & barcodingBOLD23 specimens

Genome at a glanceGoaT · TreeOfSex2n = 12

01Narrative

Trypetoptera punctulata is a species of fly in the family Sciomyzidae. It is found in the Palearctic.Unlike most Sciomyzids, it is found in dry habitats, especially calcareous woodlands and also on grassland and along the edges of streams Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi.Séguy, E. (1934) Diptères: Brachycères. II. Muscidae acalypterae, Scatophagidae. Paris: Éditions Faune de France 28 (FdeFr28)Dipt.Brachyceres.pdf Bibliotheque Virtuelle Numerique pdf The larva preys on Helicidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)saprophagous

Feeding guild (larval)parasitoid

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypetoptera punctulata has left across the world's sequence archives.

At a glance

DNA specimens23

BINs5

Marker genes1

eDNA detections106

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 72% of positions are identical in every specimen.

Where individuals differ — all 184 variable positions, in barcode order

1Amostly conserved

4Tvariable

5Cmostly conserved

7Tmostly conserved

10Cmostly conserved

14Amostly conserved

18Tmostly conserved

25Tmostly conserved

40Gmostly conserved

42Gmostly conserved

43Tmostly conserved

44Amostly conserved

48Cmostly conserved

49Tmostly conserved

55Tmostly conserved

56Amostly conserved

58Cvariable

59Cmostly conserved

61Tmostly conserved

70Tmostly conserved

78Gmostly conserved

79Cvariable

82Cvariable

88Tvariable

97Tvariable

100Amostly conserved

103Tmostly conserved

104Gmostly conserved

106Cvariable

109Avariable

112Tmostly conserved

119Gmostly conserved

120Tmostly conserved

121Amostly conserved

123Tmostly conserved

125Gmostly conserved

126Tmostly conserved

127Avariable

128Amostly conserved

129Cmostly conserved

130Gvariable

131Gmostly conserved

132Cmostly conserved

133Tmostly conserved

134Cmostly conserved

135Amostly conserved

136Tmostly conserved

137Gmostly conserved

138Cmostly conserved

139Tmostly conserved

143Gmostly conserved

144Tmostly conserved

145Amostly conserved

147Tmostly conserved

148Gmostly conserved

149Amostly conserved

150Tmostly conserved

163Avariable

166Gmostly conserved

173Amostly conserved

178Tvariable

181Tmostly conserved

190Tvariable

196Gmostly conserved

197Cvariable

211Amostly conserved

217Avariable

226Tmostly conserved

227Amostly conserved

229Amostly conserved

232Cmostly conserved

241Amostly conserved

247Cvariable

265Amostly conserved

268Avariable

280Cvariable

283Cmostly conserved

284Cvariable

286Cvariable

295Gvariable

298Tmostly conserved

301Amostly conserved

313Tmostly conserved

325Tmostly conserved

334Gmostly conserved

353Tmostly conserved

355Tmostly conserved

370Tvariable

373Avariable

376Tvariable

379Avariable

391Amostly conserved

394Tmostly conserved

400Tmostly conserved

412Tmostly conserved

415Amostly conserved

418Amostly conserved

421Tmostly conserved

424Amostly conserved

431Gmostly conserved

433Tmostly conserved

439Amostly conserved

440Amostly conserved

441Amostly conserved

442Cvariable

448Tmostly conserved

457Gmostly conserved

458Amostly conserved

466Amostly conserved

470Gmostly conserved

472Tmostly conserved

481Amostly conserved

483Cmostly conserved

490Tmostly conserved

493Gvariable

496Amostly conserved

497Cmostly conserved

499Tmostly conserved

500Tvariable

502Gmostly conserved

+64 more variable positions not shown

AACTCTTTACTTTATTTTTGGTGCTTGAGCTGGAATAGTGGGTACTTCTCTGAGTATCCTTATTCGAGCTGAACTTGGCCACCCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)8.2%

Haplotypes5

BINs5

Most divergent pair3.5%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pegoplata aestivasame order16.5%Tabanus ceylonicussame order16.6%Fannia carbonariasame order16.6%Fannia armatasame order16.8%Tabanus reinwardtiisame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Trypetoptera punctulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records12–122n range12median12mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 124×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Boyes, J., L. Knutson and J. M. Van Brink (1972). "Further cytotaxonomic studies of Sciomyzidae, with description of a new species, Dichetophora boyesi Steyskal (Diptera: Acalyptratae)." Genetica 43(3): 334-365. ↗

08Occurrence & distribution

Record type8 043 records

Wild obs. + sensor6 589

Museum / vouchered1 454

Range

Area of Occupancy AOO18 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 2 729≤1 km 1 224≤10 km 1 642>10 km 110

5 705 georeferenced · 884 without coordinates

Open the mapobservation + sensor6 589

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 494≤1 km 583≤10 km 237>10 km 3

1 317 georeferenced · 137 without coordinates

Open the institutions mapphysical evidence1 454

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	421
Helsinki, FI	229
SLU Artdatabankenlocation not on record	142
NHMOlocation not on record	93
Dipterist Forumlocation not on record	77
Stockholm, SE	49
University of Tokyo, Department of Zoologylocation not on record	39
Gothenburg, SE	35
ZMAAlocation not on record	33
CBDClocation not on record	19
Tilburg, NL	18
Philadelphia, US	17
SRS22021location not on record	15
Metsähallituslocation not on record	14
NCMGlocation not on record	13
DFFW2016location not on record	8
neflocation not on record	7
Kuopio, FI	6
South Kensington, GB	5
MZLUlocation not on record	5
DFFW2018location not on record	4
DFFW1981location not on record	3
Natural History Museum, Londonlocation not on record	3
Tromsø, NO	2
DFlocation not on record	2
SGAV-and-NHMDlocation not on record	1
University of Turku, Zoological Museumlocation not on record	1
BioFokuslocation not on record	1
Wellcome Sanger Institutelocation not on record	1

29 institutions · 1 263 of 1 454 vouchered records shown · 191 without an institution code

09Environmental DNA106 detections

Where the DNA of Trypetoptera punctulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found106

Studies independent surveys4

Countries7

Verifiable raw sequence linked94

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 106 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 12.5–16.9

Seasonal swing summer↔winter21.9 °C

Max temp (day)18.5 °C 14.8–20.6

Min temp (night)10.7 °C 8.10–13.3

Precipitation89.5 mm/mo 65.3–105

Air humidity61.1 % 58.5–63.0

Moisture balance8.20 mm/mo -56.0–37.6

Vapour deficit660 Pa 536–774

Wind speed2.70 m/s 2.30–4.10

Cloud cover48.0 % 42.7–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 102 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Trypetoptera punctulata

At a glance

Sources9 archives

Diet & foraging2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type8 043 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 043 records