Trypetoptera canadensis

(Macquart, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Sciomyzidae/Trypetoptera

At a glance

Occurrence records319

Data sources7

Biological traits0

DNA specimens21

eDNA detections21

Sources7 archives

Databases and archives Trypetoptera canadensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility319 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF319 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD21 specimens

01Narrative

Trypetoptera canadensis is a species of marsh fly in the family Sciomyzidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypetoptera canadensis has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections21

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

5Cmostly conserved

6Tmostly conserved

7Tmostly conserved

9Amostly conserved

10Cmostly conserved

11Tmostly conserved

13Tmostly conserved

14Gmostly conserved

17Tmostly conserved

18Tmostly conserved

19Cmostly conserved

21Gmostly conserved

40Gmostly conserved

67Tmostly conserved

82Cmostly conserved

112Cmostly conserved

160Amostly conserved

187Tmostly conserved

190Gmostly conserved

316Gmostly conserved

433Avariable

463Cmostly conserved

479Amostly conserved

493Tvariable

616Cmostly conserved

628Gmostly conserved

AACTCTTTACTTTGTCTTCGGAGCTTGAGCAGGAATAGTGGGTACTTCCCTAAGTATTCTTATTCGTGCAGAGCTTGGACACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes11

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Limnia inopasame family16.0%Pegoplata aestivasame order16.5%Rivellia variabilissame order17.2%Tetanocera silvaticasame family17.2%Trichoclinocera minorsame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type319 records

Wild obs. + sensor250

Museum / vouchered69

Range

Area of Occupancy AOO1 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 137≤1 km 39≤10 km 8>10 km 21

205 georeferenced · 45 without coordinates

Open the mapobservation + sensor250

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	21
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Washington, US	9
Montgomery, US	8
OSUClocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Wuzhou, CN	1
Biodiversity Institute of Ontariolocation not on record	1
Champaign, US	1
Toronto, CA	1

10 institutions · 55 of 69 vouchered records shown · 14 without an institution code

09Environmental DNA21 detections

Where the DNA of Trypetoptera canadensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

1. Forest & WoodlandForestGrasslandMixed habitatWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 15.4–21.7

Seasonal swing summer↔winter27.7 °C

Max temp (day)21.6 °C 19.6–24.4

Min temp (night)13.6 °C 10.2–18.1

Precipitation92.7 mm/mo 65.1–107

Air humidity59.1 % 56.2–61.3

Moisture balance-41.7 mm/mo -80.5–3.60

Vapour deficit795 Pa 688–1,086

Wind speed2.90 m/s 2.40–3.70

Cloud cover40.2 % 37.9–51.1

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)