Trypauchen vagina

(Bloch & Schneider, 1801) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Trypauchen

At a glance

Occurrence records337

Data sources10

Biological traits6

DNA specimens143

eDNA detections196

Sources10 archives

Databases and archives Trypauchen vagina's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility174 records↗

OBISOcean Biodiversity Information System163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI196 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics143 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS337 records

Environmental DNA1 datasets · 9 countries196 detections

DNA & barcodingBOLD143 specimens

01Narrative

Trypauchen vagina, commonly known as the burrowing goby, is a species of eel goby found in the Indo-Pacific region. It has an elongated body about 20 to in length. It is reddish-pink in color and possesses distinctive pouches in the upper edges of its gill covers. It lives in burrows in the silty and muddy bottoms of its marine and brackish habitats. It has reduced eyes that are entirely covered with skin and the anterior portion of its head is protected by thick flesh. Both adaptations aid it in digging its burrows.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length22 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceminor commercial

Other traits1

Vulnerability24.01

05DNA & barcoding143 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypauchen vagina has left across the world's sequence archives.

At a glance

DNA specimens143

BINs3

Marker genes11

eDNA detections196

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P614 bp consensus132 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 57 variable positions, in barcode order

24Cvariable

36Amostly conserved

54Cmostly conserved

57Amostly conserved

69Gmostly conserved

87Gmostly conserved

120Gmostly conserved

129Cvariable

138Cvariable

153Cmostly conserved

156Gmostly conserved

165Tmostly conserved

192Cmostly conserved

195Cmostly conserved

204Gmostly conserved

207Tmostly conserved

210Tmostly conserved

243Gmostly conserved

249Tmostly conserved

250Tmostly conserved

252Amostly conserved

264Amostly conserved

270Amostly conserved

282Gmostly conserved

288Gmostly conserved

303Cmostly conserved

309Tmostly conserved

315Amostly conserved

330Amostly conserved

342Tmostly conserved

357Tmostly conserved

363Amostly conserved

366Tmostly conserved

375Gmostly conserved

388Cmostly conserved

390Gmostly conserved

393Gmostly conserved

408Cmostly conserved

414Amostly conserved

426Gmostly conserved

432Tmostly conserved

435Cmostly conserved

450Tmostly conserved

459Tmostly conserved

477Tmostly conserved

480Cmostly conserved

489Amostly conserved

492Amostly conserved

493Cmostly conserved

495Tmostly conserved

501Cmostly conserved

504Gmostly conserved

508Cmostly conserved

510Gmostly conserved

522Amostly conserved

528Tmostly conserved

558Gmostly conserved

GGGACAGCTTTAAGCCTTCTTATCCGTGCTGAACTAAGTCAACCAGGGGCTCTCTTAGGGGATGATCAGATTTACAATGTAATTGTGACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes37

BINs3

Most divergent pair10.4%

OtherAsiaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paratrypauchen microcephalussame family8.1%Amblyotrypauchen arctocephalussame family13.8%Boleophthalmus dussumierisame family14.3%Parapocryptes rictuosussame family14.7%Taenioides anguillarissame family15.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_016693 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type337 records

Wild obs. + sensor73

Museum / vouchered260

Other4

Origin

Native4

Range

Area of Occupancy AOO600 km²

Depth

0–200 m sunlit14

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 20 m · max 90 m · 14 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 2≤1 km 3≤10 km 2>10 km 8

15 georeferenced · 58 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 14≤1 km 9≤10 km 23>10 km 36

82 georeferenced · 178 without coordinates

Open the institutions mapphysical evidence260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	16
Kagoshima University Museumlocation not on record	16
Paris, FR	13
Washington, US	11
Ann Arbor, US	7
	3
Cambridge, US	3
Louisiana State University, Museum of Zoologylocation not on record	3
FishBaselocation not on record	3
Chicago, US	3
Frankfurt am Main	2
SEAOBISlocation not on record	2
Toronto, CA	2
North Carolina Museum of Natural Scienceslocation not on record	1
University of Minnesota, James Ford Bell Museum of Natural Historylocation not on record	1
Honolulu, US	1
SMNHTAUlocation not on record	1
Izmir Katip Celebi University. Queensland Museum, Brisbanelocation not on record	1
Wuzhou, CN	1
Copenhagen, DK	1
Museu de Zoologia da Universidade de Sao Paulolocation not on record	1
South Kensington, GB	1
Hebrew University of Jerusalemlocation not on record	1

23 institutions · 94 of 260 vouchered records shown · 50 without an institution code

09Environmental DNA196 detections

Where the DNA of Trypauchen vagina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found196

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 196 detections have coordinates

Open the map9 countries0

MarineMangroveSandy BottomEstuary

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 16.5–27.9

Seasonal swing summer↔winter11.1 °C

Max temp (day)27.9 °C 17.9–29.9

Min temp (night)24.1 °C 15.2–26.9

Precipitation121 mm/mo 23.1–263

Air humidity63.7 % 59.0–67.5

Moisture balance162 mm/mo

Vapour deficit1,214 Pa 773–1,362

Wind speed4.50 m/s

Cloud cover43.4 % 30.7–52.9

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)