Trypanophora semihyalina

Kollar, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Zygaenidae/Trypanophora

At a glance

Occurrence records593

Data sources7

Biological traits0

DNA specimens5

eDNA detections8

Sources7 archives

Databases and archives Trypanophora semihyalina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility593 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF593 records

Environmental DNA1 datasets · 4 countries8 detections

DNA & barcodingBOLD5 specimens

01Narrative

Trypanophora semihyalina is a species of moth in the Zygaenidae family. It is found in south-east Asia, including India, China, Hong Kongand parts of Taiwan. The larvae have been recorded feeding on Barringtonia acutangula, Bombax ceiba, Careya, Carissa carandas, Gardenia, Holarrhena, Lagerstroemia (including Lagerstroemia indica and Lagerstroemia speciosa), Ricinus communis, Rosa, Shorea robusta, Terminalia (including Terminalia catappa and Terminalia tomentosa) and Ziziphus (including Ziziphus mauritiana).HOSTS - a Database of the World's Lepidopteran Hostplants

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypanophora semihyalina has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.96%

Haplotypes1

BIN1

Where individuals differ — all 12 variable positions, in barcode order

50Tmostly conserved

117Tmostly conserved

177Cmostly conserved

210Amostly conserved

216Amostly conserved

381Amostly conserved

402Tvariable

507Amostly conserved

561Gmostly conserved

564Tmostly conserved

615Tmostly conserved

621Amostly conserved

ACATTATATTTTATTTTTGGAATTTGATCAGGTATAGTAGGAACCTCTCTAAGATTATTAATTCGAGCTGAATTAGGTAACCCTGGATCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eterusia aedeasame family8.8%Cadphises maculatasame family9.6%Psaphis euschemoidessame family9.7%Scopula incanatasame order10.8%Ganisa similissame order11.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type593 records

Wild obs. + sensor590

Museum / vouchered3

Range

Area of Occupancy AOO1 468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 161≤1 km 130≤10 km 82>10 km 67

440 georeferenced · 150 without coordinates

Open the mapobservation + sensor590

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA8 detections

Where the DNA of Trypanophora semihyalina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map4 countries0

Subtropical forestCastor

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 16.4–28.2

Seasonal swing summer↔winter16.6 °C

Max temp (day)20.9 °C 19.9–30.9

Min temp (night)13.3 °C 11.9–24.8

Precipitation189 mm/mo 154–333

Air humidity59.5 % 59.1–67.9

Moisture balance96.4 mm/mo 47.8–207

Vapour deficit831 Pa 807–1,226

Wind speed2.10 m/s 1.70–2.70

Cloud cover37.4 % 29.4–40.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)