Tropaeolum tuberosum

Ruiz & Pav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Tropaeolaceae/Tropaeolum

At a glance

Occurrence records776

Data sources14

Biological traits20

DNA specimens1

eDNA detections1

Sources14 archives

Databases and archives Tropaeolum tuberosum's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility776 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionDukesPhytochem · LOTUS22 compounds

Occurrence & distributionGBIF776 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB1.2 Gbp

01Narrative

Tropaeolum tuberosum (mashua, see below for other names) is a species of flowering plant in the family Tropaeolaceae, grown in the Andes, particularly in Peru and Bolivia, and to a lesser extent in Ecuador as well as in some areas of Colombia, for its edible tubers, which are eaten cooked or roasted as a vegetable. It is a minor food source, especially to native Amerindian populations. Mashua is a herbaceous perennial climber growing to 2 - in height. It is related to garden nasturtiums, and is occasionally cultivated as an ornamental for its brightly coloured tubular flowers.Grau, Ortega, Nieto & Hermann (2003) Mashua (Tropaeolum tuberosum Ruíz & Pav.). [Extensive monograph on mashua] http://www.bioversityinternational.org/uploads/tx_news/Mashua__Tropaeolum_tuberosum_Ru%C3%ADz__amp__Pav._880.pdf

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height2 m

Seed mass140 mg

Seed mass max140 mg

Seed mass min140 mg

Life cycle & reproduction5

Life formclimbing tuberous geophyte

Life spanannual

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Elevation max3 600 m

Elevation min2 500 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Vine

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition22 compounds

Compounds documented for Tropaeolum tuberosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile2 classes

Anthocyanidins5

Glucosinolates1

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
WATER	921,000 ppm	DukesPhytochem
CARBOHYDRATES	786,000 ppm	DukesPhytochem
PROTEIN	115,000 ppm	DukesPhytochem
ASH	57,000 ppm	DukesPhytochem
FIBER	57,000 ppm	DukesPhytochem
FAT	42,850 ppm	DukesPhytochem
ASCORBIC-ACID	4,800 ppm	DukesPhytochem
PHOSPHORUS	3,000 ppm	DukesPhytochem
CALCIUM	500 ppm	DukesPhytochem
IRON	85 ppm	DukesPhytochem

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tropaeolum tuberosum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF254060.1 ↗569 bp

ACGT

GAGAACATGTATCTACCGATGGTTGGTTTAACTCTTTGAGTTGTATCGGCCTTAAGTGAAGTGAAAATTGAATATGAACTTTAGCAACAT …

Tropaeolum tuberosum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Tropaeolum tuberosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 235 972 448 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Tropaeolum tuberosum1.24 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidy2× diploid · measured

Chromosome records42–422n range42median42mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 422×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Sugiura 1936a, b

CCDB · book-atlas-flowering-plants — Sugiura 1936a, b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type776 records

Wild obs. + sensor210

Museum / vouchered175

Cultivated / captive287

Other104

Origin

Introduced1

Range

Area of Occupancy AOO812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 68≤1 km 32≤10 km 9>10 km 4

113 georeferenced · 97 without coordinates

Open the mapobservation + sensor210

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤1 km 5≤10 km 16>10 km 1

22 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence175

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy1% within 1 km

≤1 km 1≤10 km 22>10 km 168

191 georeferenced · 96 without coordinates

Open the mapnot free-living287

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	52
Saint Louis, US	24
Pontificia Universidad Javeriana (PUJ)location not on record	15
Xiamen, CN	12
Aarhus, DK	11
Kew, GB	8
Stockholm, SE	7
La Paz, BO	5
Arequipa, PE	4
Jardín Botánico José Celestino Mutis (JBBJCM)location not on record	4
Auckland, NZ	4
Vancouver, CA	4
BMlocation not on record	3
Göteborg, SE	3
Altos de Pipe, VE	2
Universidad de Nariño (UdeNar)location not on record	2
Tampa, US	2
UTPLlocation not on record	1
Cusco, PE	1
University of Stellenboschlocation not on record	1
Paris, FR	1
Museo Entomologico de Leonlocation not on record	1
Universidad Privada Antenor Orregolocation not on record	1
QCNElocation not on record	1
Universidad de Antioquia (UdeA)location not on record	1
Bronx, US	1
Universidad de Caldas (UCaldas)location not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
South Kensington, GB	1
Quito, EC	1

30 institutions · 175 of 175 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Tropaeolum tuberosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)