Tropaeolum tricolor

Sw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Tropaeolaceae/Tropaeolum

At a glance

Occurrence records1 265

Data sources6

Biological traits16

DNA specimens17

eDNA detections12

Sources6 archives

Databases and archives Tropaeolum tricolor's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF1 265 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI17 specimens

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass23.5 mg

Seed mass max23.5 mg

Seed mass min23.5 mg

Life cycle & reproduction3

Life formclimbing tuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberobligatory

Elevation max2 800 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tropaeolum tricolor has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes8

GenBank sequences10

eDNA detections12

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ007294.1 ↗645 bp

ACGT

TCGAAACCTGCATAGCAGAACGACTCGAGAATATGTTAAAATACTTTGAGCTCGGATGGCTCATTGAGCTGTCTGTCTCATTGCAAAGTG …

Tropaeolum tricolor isolate TT9ITS internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★trnL-F★ITS9★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type1 265 records

Wild obs. + sensor1 240

Museum / vouchered25

Range

Area of Occupancy AOO2 368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 594≤1 km 256≤10 km 93>10 km 35

978 georeferenced · 262 without coordinates

Open the mapobservation + sensor1 240

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1>10 km 1

2 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Valparaiso, CL	20
MAlocation not on record	2
Auckland, NZ	2
Universidad de La Serenalocation not on record	1

4 institutions · 25 of 25 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Tropaeolum tricolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 12.0–12.0

Seasonal swing summer↔winter7.10 °C

Max temp (day)17.6 °C

Min temp (night)9.40 °C

Precipitation21.2 mm/mo

Air humidity66.1 %

Moisture balance-55.6 mm/mo

Vapour deficit472 Pa

Wind speed4.40 m/s

Cloud cover23.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tropaeolum tricolor

At a glance

Sources6 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

At a glance

Record type1 265 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 265 records