Tropaeolum speciosum

Poepp. & Endl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Tropaeolaceae/Tropaeolum

At a glance

Occurrence records1 050

Data sources10

Biological traits26

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Tropaeolum speciosum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 050 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionLOTUS · NPASS70 compounds

Occurrence & distributionGBIF1 050 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Tropaeolum speciosum, the flame flower or flame nasturtium, is a species of flowering plant in the family Tropaeolaceae native to Chile, where it is known locally as coralito, quintralito, or voqui.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Fruit length6 mm

Fruit width5 mm

Leaf length max95 mm

Plant height4 m

⚠ sources differ — GIFT: 4 m · TRY: 1.5 m

Plant height max8 m

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Life formclimbing tuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualpresent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberobligatory

Elevation max1 500 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Habitat GIFTLowland

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition70 compounds

Compounds documented for Tropaeolum speciosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Guaiane sesquiterpenoids22

Germacrane sesquiterpenoids9

Flavones9

Flavonols8

Bisabolane sesquiterpenoids6

Documented compounds70 total

Tissue Source Quantified only

Compound	Amount	Source
(17Z)-17-Hexacosenoic acid	present	LOTUS
(1R,2S,3S,6R,7S,10R,11S)-1,6,10-trimethyl-4,14-dioxatetracyclo[9.2.1.02,10.03,7]tetradecan-5-one	present	NPASS
(1R,4S,5S)-2-methyl-5-[(2R)-6-methylhept-5-en-2-yl]cyclohex-2-ene-1,4-diol	present	NPASS
(1S,2S,4R,7E,11S,12R)-4,8,12-trimethyl-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-en-13-one	present	NPASS
(3R,3As,5aR,6R,9aS,9bS)-6-hydroxy-3,5a-dimethyl-9-methylidene-3a,4,5,6,7,8,9a,9b-octahydro-3H-benzo[g][1]benzofuran-2-one	present	NPASS
(3R,3aS,5aR,6R,9bS)-6-hydroxy-3,5a,9-trimethyl-3,3a,4,5,6,7,8,9b-octahydrobenzo[g][1]benzofuran-2-one	present	NPASS
(3R,3aS,5aR,6R,9R,9aS,9bS)-6,9-dihydroxy-3,5a,9-trimethyl-3a,4,5,6,7,8,9a,9b-octahydro-3H-benzo[g][1]benzofuran-2-one	present	NPASS
(3R,3aS,7R,10E,11aS)-7-hydroxy-3,10-dimethyl-6-methylidene-3,3a,4,5,7,8,9,11a-octahydrocyclodeca[b]furan-2-one	present	NPASS
(3S,3aR,4S,6S,9bS)-4-(Acetyloxy)-3a,4,5,6,8,9b-hexahydro-6-hydroxy-3,6,9-trimethylazuleno[4,5-b]furan-2(3H)-one	present	NPASS
(3S,3aR,4S,6S,9bS)-4-(Acetyloxy)-3a,5,6,9b-tetrahydro-6-hydroxy-3,6,9-trimethyl-4H-cyclohepta(2,1-b:3,4-c')difuran-2(3H)-one	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tropaeolum speciosum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF254052.1 ↗613 bp

ACGT

GAGAATATGTTAAAATACTCGGAGCTCGGATGGCTCATCGAGCTGTCCGTCTCATTGCAAAGTGAGACCAGGACTAGGCCAATTGCATCT …

Tropaeolum speciosum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 050 records

Wild obs. + sensor771

Museum / vouchered119

Cultivated / captive160

Origin

Native1

Introduced65

Range

Area of Occupancy AOO1 772 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 396≤1 km 109≤10 km 119>10 km 12

636 georeferenced · 135 without coordinates

Open the mapobservation + sensor771

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 4

13 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence119

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 2

4 georeferenced · 156 without coordinates

Open the mapnot free-living160

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	60
Auckland, NZ	21
Chicago, US	9
Rotorua, NZ	6
Edinburgh, GB	6
Wellington, NZ	5
Olocation not on record	3
BSBIlocation not on record	2
UChlocation not on record	2
Vancouver, CA	1
Viña del Mar, CL	1
INTAlocation not on record	1
Saint Louis, US	1
South Kensington, GB	1

14 institutions · 119 of 119 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Tropaeolum speciosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Tropaeolum speciosum

At a glance

Sources10 archives

Size & morphology5

Life cycle & reproduction9

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Compound class profile5 classes

Documented compounds70 total

At a glance

Record type1 050 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 14 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 050 records