Tropaeolum polyphyllum

Cav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Tropaeolaceae/Tropaeolum

At a glance

Occurrence records270

Data sources7

Biological traits11

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Tropaeolum polyphyllum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF270 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

كبوسين متعدد الأوراق هو نوع من النباتات يتبع جنس الكبوسين من الفصيلة الكبوسينية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberobligatory

Elevation max3 700 m

Elevation min2 000 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Liana

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tropaeolum polyphyllum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences5

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAF254041.1 ↗613 bp

ACGT

GAGAATATGTTCAAATACTTGGAGCGCGGACGGCTCATTGAGCTGTCTGTCCCATTGCAAAGTGAGACCCGGACATGTCCGATTGCAACT …

Tropaeolum polyphyllum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type270 records

Wild obs. + sensor206

Museum / vouchered57

Cultivated / captive7

Origin

Native14

Introduced2

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 93≤1 km 36≤10 km 15>10 km 3

147 georeferenced · 59 without coordinates

Open the mapobservation + sensor206

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence57

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 5 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
INTAlocation not on record	11
Valparaiso, CL	10
Chicago, US	9
Saint Louis, US	5
San Isidro, AR	5
UChlocation not on record	3
Edinburgh, GB	3
MAlocation not on record	2
Viña del Mar, CL	2
Castelar, AR	2
Kew, GB	1
University of Stellenboschlocation not on record	1
Auckland, NZ	1
Istituto Agrario Castelnuovolocation not on record	1

14 institutions · 56 of 57 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Tropaeolum polyphyllum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)