Tropaeolum brachyceras — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Tropaeolaceae/Tropaeolum

At a glance

Occurrence records320

Data sources8

Biological traits11

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Tropaeolum brachyceras's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF320 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Tropaeolum brachyceras is a species of perennial plant in the Tropaeolaceae family. It is endemic to mountainous regions of Chile.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formclimbing tuberous geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 400 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Tropaeolum brachyceras has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences5

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSAF253996.1 ↗612 bp

ACGT

GAGAATATGTTAAAATACTTCGAGCTCGGATGGCTCCTTGAGCTGTCTGTCTCATTGCAAAGTGAAACCCGGACAAAGCCAATTGCAACT …

Tropaeolum brachyceras internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1ITS4ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type320 records

Wild obs. + sensor297

Museum / vouchered22

Fossil1

Range

Area of Occupancy AOO664 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 152≤1 km 38≤10 km 31>10 km 12

233 georeferenced · 64 without coordinates

Open the mapobservation + sensor297

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UChlocation not on record	11
Valparaiso, CL	4
Chicago, US	2
Viña del Mar, CL	2
Edinburgh, GB	2
MAlocation not on record	1

6 institutions · 22 of 22 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Tropaeolum brachyceras was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.