Trollius yunnanensis

(Franch.) Ulbr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Trollius

At a glance

Occurrence records428

Data sources10

Biological traits16

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Trollius yunnanensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility428 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF428 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trollius yunnanensis, the Yunnan globeflower (), is a species of globeflower, native to southern China; Gansu, Sichuan and Yunnan provinces, and to northern Myanmar. A perennial, it prefers to grow at elevations from 1,900m up to 3,900m on grassy slopes and wet meadows. It has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length10 mm

Fruit length max11 mm

Fruit length min9 mm

Fruit width3 mm

Fruit width max3 mm

Fruit width min3 mm

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max4 540 m

Elevation mean3 150 m

Elevation min2 400 m

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trollius yunnanensis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF785706.1 ↗327 bpChina · 2009

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGTCACTAGATCGAGGGCACGTCTGCCTGGGCGTCACACACA …

Trollius yunnanensis 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trollius yunnanensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1610×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora +2

CCDB · ipcn-api-dl — Yang, Q. e. 2002. Cytology of the tribe Trollieae and of the tribe Cimicifugeae in the Ranunculaceae: a comparative study. Acta Phytotax. Sin. 40(1): 52–65.

CCDB · ipcn-api-dl — Yuan, Q. 2006. Tribal relationships of Beesia, Eranthis and seven other genera of Ranunculaceae: evidence from cytological characters. Bot. J. Linn. Soc. 150: 267–289.

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.

CCDB · book-ipcn67-71 — DOROSZEWSKA, A. 1967. Chromosomes of some Trollius species. Act. Polsk. Towarz. Bot. 36: 567-577.

CCDB · eflora

CCDB · book-fedorov — KYROBa 1961

CCDB · book-fedorov — Gregory W~ C. 1941

CCDB · book-atlas-flowering-plants — Gregory 1941

n 81×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — DOROSZEWSKA, A. 1970. Hybrids of Trollius pumilus Don with other species of the same genus. Acta Soc. Bot. Poloniae 39: 257-284.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type428 records

Wild obs. + sensor1

Museum / vouchered424

Cultivated / captive2

Other1

Range

Area of Occupancy AOO384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 424 records without

Open the institutions mapphysical evidence424

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	194
Chengdu, CN	74
Chengdu, CN	51
Cambridge, US	25
CASlocation not on record	14
Guangzhou, CN	13
Yunnan Universitylocation not on record	10
Cambridge, US	8
Strecker Museum, Baylor Universitylocation not on record	7
University of Stellenboschlocation not on record	6
Kunming, CN	4
Kew, GB	3
Yangling, CN	3
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	2
Saint Louis, US	2
Edinburgh, GB	1
Taipei, TW	1
SABGlocation not on record	1
Siouxland Heritage Museumlocation not on record	1
Seoul, KR	1

20 institutions · 421 of 424 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Trollius yunnanensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)