Trollius chinensis

Bunge · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Trollius

At a glance

Occurrence records561

Data sources12

Biological traits34

DNA specimens3

eDNA detections3

Sources12 archives

Databases and archives Trollius chinensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility561 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Chemical compositionLOTUS · NPASS76 compounds

Occurrence & distributionGBIF561 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Trollius chinensis, the Chinese globeflower, is a species of flowering plant in the family Ranunculaceae, found from southern Siberia to the southern Russian Far East, Sakhalin, the Kurils, Mongolia, Korea, and northern China (to north Henan). Its cultivar 'Golden Queen' has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length12 mm

Fruit length max13 mm

Fruit length min10 mm

Fruit width3.5 mm

Fruit width max4 mm

Fruit width min3 mm

Leaf size1 125 mm²

Leaf width max125 mm

Leaf width min68 mm

Plant height0.5 m

Plant height max1.5 m

Plant height min0.3 m

Life cycle & reproduction7

Flower length max55 mm

Flower length min38 mm

Flowering endJun

Flowering startMay

Life formperennial

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 200 m

Elevation mean1 062 m

Elevation min450 m

Growth formherb

Habitat GIFTcut-over forest, forest edges, meadows: wet, shrubberies

Woodinessnon-woody

Physiology & chemistry4

Leaf c362 mg/g

Leaf dry-matter content (LDMC)239 mg/g

Leaf n13.7 mg/g

Leaf p1.9 mg/g

Other traits1

Plant support typefree-standing

03Chemical composition76 compounds

Compounds documented for Trollius chinensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones11

Flavonols8

Simple phenolic acids4

Quinoline alkaloids4

Stigmastane steroids3

Documented compounds76 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-taxifolin	present	NPASS
(1R,5S,6R)-5-hydroxy-3-methoxy-7-oxabicyclo[4.1.0]hept-3-en-2-one	present	NPASS
(1R,8S,9R,16R,18S,27S)-9-(3,4-dihydroxyphenyl)-5,8,16,21,23-pentahydroxy-2,10,17,26-tetraoxaheptacyclo[14.11.1.01,13.03,12.06,11.018,27.020,25]octacosa-3(12),4,6(11),13,20,22,24-heptaen-15-one	present	NPASS
(2S,3R)-2,3-dimethyl-3-[2-[(4R)-2,2,5,5-tetramethyl-1,3-dioxolan-4-yl]ethyl]-2,9-dihydrofuro[2,3-b]quinolin-4-one	present	NPASS
(3R)-3-(2-methylbut-3-en-2-yl)-3-(3-methylbut-2-enyl)-1H-quinoline-2,4-dione	present	NPASS
(E)-N-(2-hydroxyethyl)-3-[(S)-methylsulfinyl]prop-2-enamide	present	NPASS
(S)-(-)-oleracetin E	present	LOTUS
(S)-Naringenin	present	NPASS
2'-Methylisoliquiritigenin	present	NPASS
2(1H)-Quinolinone, 3-(3-methyl-2-butenyl)-4-[(3-methyl-2-butenyl)oxy]-	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trollius chinensis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX423848.1 ↗202 bpChina · 2025

ACGT

ACAGCGTCGTTCCCCACCAATCTTGTTGGTTGGGCAACGGAGATTGGCCCCCCGAGTCTTCACAGGCACGGTCGGCATAAATATCGGTCC …

Trollius chinensis voucher HY15 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★ITS8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Trollius chinensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 166×CCDB · book-ipcn66 · CCDB · book-ipcn67-71 · CCDB · eflora +1

CCDB · book-ipcn66 — Sokolovskaya 1966

CCDB · book-ipcn67-71 — DOROSZEWSKA, A. 1967. Chromosomes of some Trollius species. Act. Polsk. Towarz. Bot. 36: 567-577.

CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.

CCDB · eflora

CCDB · iapt — IAPT/IOPB Chromosome Data 32

CCDB · iapt — IAPT/IOPB Chromosome Data 33

n 81×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — DOROSZEWSKA, A. 1970. Hybrids of Trollius pumilus Don with other species of the same genus. Acta Soc. Bot. Poloniae 39: 257-284.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type561 records

Wild obs. + sensor262

Museum / vouchered295

Cultivated / captive2

Other2

Origin

Introduced1

Range

Area of Occupancy AOO1 240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 68≤1 km 35≤10 km 56>10 km 52

211 georeferenced · 51 without coordinates

Open the mapobservation + sensor262

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 1≤1 km 4≤10 km 3>10 km 5

13 georeferenced · 282 without coordinates

Open the institutions mapphysical evidence295

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	110
Moscow State Universitylocation not on record	25
Beijing Normal Universitylocation not on record	14
Xining, CN	13
Institute of Applied Ecology, Academia Sinicalocation not on record	11
SXTCMlocation not on record	11
Yangling, CN	8
Shanxi Universitylocation not on record	8
Kyoto Universitylocation not on record	8
Jiangxi College of Educationlocation not on record	7
Xinxiang, CN	7
Nanjing, CN	7
Shanxi Institute of Biologylocation not on record	6
Herbarium of the Department of Botany, University of Tokyolocation not on record	5
Shanghai, CN	4
Tianjin Natural History Museumlocation not on record	4
Beijing, CN	4
Museo universitario di Chietilocation not on record	3
Peking Universitylocation not on record	3
Port Elizabeth Museum (Bayworld)location not on record	3
Santa Barbara, US	2
Saint Louis, US	2
Tsukuba, JP	2
WNNUlocation not on record	2
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	2
Guangzhou, CN	2
Institute of the biological problems of the North FEB RASlocation not on record	2
Taipei, TW	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
MeiseBGlocation not on record	1
Chengdu, CN	1
WTUlocation not on record	1
Olocation not on record	1
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Inner Mongolia Universitylocation not on record	1
Hebei Normal Universitylocation not on record	1
Guangzhou, CN	1
Wuhan, CN	1
Bronx, US	1
Taiyuan Normal Universitylocation not on record	1
Beijing Natural History Museumlocation not on record	1
IWEP FEB RASlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

43 institutions · 291 of 295 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Trollius chinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 0.2–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 4.50–15.7

Min temp (night)3.10 °C -5.00–3.10

Precipitation13.8 mm/mo 13.8–32.0

Air humidity45.7 % 45.7–57.5

Moisture balance-95.2 mm/mo -95.2–-27.1

Vapour deficit827 Pa 457–827

Wind speed4.50 m/s 2.60–4.50

Cloud cover24.1 % 24.1–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)